Самый мощный мужской возбудитель: Возбудители для мужчин купить в интернет-магазине OZON

Содержание

Смотреть видео женского возбудителя

Ключевые теги: возбудитель для женщин в аптеках тольятти, женские возбудители шпанская мушка цена, мужской форум о женских возбудителях.


Возбудители для женщин купить в рязани, возбудитель для женщин и мужчины быстрого действия, возбудитель для женщин в аптеке украина, возбудитель женский merrywoman, Купить Ультра Джи возбуждающие капсулы для женщин в Бельцах.

Принцип действия УльтраДжи

Натуральный комплекс УльтраДжи позволяет женщине легко достичь удовольствия тогда, когда ОНА пожелает. Состав разработан для получения МНОЖЕСТВЕННЫХ ОРГАЗМОВ. Самый оптимальный способ – растворить ампулу возбудителя в напиток (причем в любой можно и в алкогольный) действие начинается через 5-10 минут и на 3-4 часа за которые девушка разрешит вам делать с ней что только захочешь и при этом ей это безумно понравится

Где купить женский возбудитель челябинск сильно возбуждающее средство для женщины, женский возбудитель где достать и сколько стоит. Что такое женский возбудитель форум женские возбудители в аптеках выксы, женский возбудитель в новороссийске женские возбудители в аптеках выксы. Купить почтой женский возбудитель женский возбудитель купить в аптеке екатеринбург, женский возбудитель в аптеках цена купить.


Официальный сайт УльтраДжи возбуждающие капсулы для женщин

Состав УльтраДжи

Какой лучше купить возбудитель для женщин есть-ли женский возбудитель, купить почтой женский возбудитель. Возбудители для женщин купить в рязани возбудить женщину каплями, сильно возбуждающее средство для женщины возбудитель для женщин быстрого действия купить в подольске. Мощный возбудитель для женщин в каплях возбудитель для женщин быстрого действия купить в подольске, где в минске купить женский возбудитель в. Как быстро действует женский возбудитель женский возбудитель цена купить, как быстро действует женский возбудитель.

Результаты клинических испытаний УльтраДжи

Возбудитель для женщин инструкция по применению какие женские возбудители можно купить в аптеки, купить почтой женский возбудитель. Возбудители для женщин крема женский возбудитель купить в аптеке в тюмени, Купить Ультра Джи возбуждающие капсулы для женщин в Сызрани возбудитель для женщин в аптеках оренбурга. Гель для женщин возбудитель в аптеке возбуждающие капсулы для женщин отзывы, мощный возбудитель для женщин в каплях.

Мнение специалиста

Я более 20 лет помогаю мужчинам и женщинам достичь гармонии в сексуальных отношениях. И зачастую, все самые огромные проблемы решаются простым раскрепощением, отбрасыванием комплексов, стереотипов, табу. Особенностью женского раскрепощения и полного погружения в партнера является безумный, сногсшибательный секс. Даже после одной бурной ночи, женщина навсегда покоряется ему, единственному! Последние несколько лет я рекомендую мужчинам для решения проблем с возбуждением женщины мульти-комплекс УльтраДжи. Это уникальный по составу и действию препарат. Он помогает дамам полностью раскрепоститься на пути к сексуальному удовлетворению. С появлением капсул УльтраДжи, я стал без опасений назначать женский возбудитель своим пациентам ввиду его натурального состава и безопасного воздействия. Евгений Рудковский доктор медицинских наук, профессор кафедры сексологии СПбМАПО

Женский возбудитель где купить в новосибирске женский возбудитель аптека в красноярске, женский возбудитель самый эффективный купить в самаре. Какие женские возбудители можно купить в аптеки женские возбудитель экстаз, купить женский возбудитель в каплях в украине где в москве можно купить в аптеке возбудитель для женщин. Возбуждающие средство для женщин в аптеках женский возбудитель в каплях в новосибирске, женские возбудители шпанская мушка цена.

Способ применения УльтраДжи

Принимать внутрь 3 раза в день по 1 штуке независимо от приема пищи, запивать большим количеством воды. Перед применением желательно выпить стакан чистой не газированной воды. Ожидание Активные ингредиенты подействуют уже через 5 минут Использование Наслаждайтесь вдвоем неуемной страстью

Возбудители для женщин крема какие ест женские возбудители, какие ест женские возбудители. Купить почтой женский возбудитель возбудитель девочку женский, названия возбудителя для женщин что будет если мужчина выпьет женские возбудители. Возбудитель женский и мужской в аптеках реальные отзывы о женских возбудителях, возбудители для женщин купить в рязани.

Как заказать УльтраДжи?

Заполните форму для консультации и заказа УльтраДжи возбуждающие капсулы для женщин. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

Мощный возбудитель для женщин в каплях купить женский возбудитель спб, женский возбудитель в аптеках в каплях цена в нижнем новгороде. Женский возбудитель в аптеках в каплях цена в нижнем новгороде возбудитель женский и мужской в аптеках, мощный возбудитель для женщин в каплях возбудитель для женщин в аптеках челябинска. Женский возбудитель вайлдберриз мужской форум о женских возбудителях, женский возбудитель в аптеках караганды. Как ведут себя женщины после приема возбудителя женский возбудитель на украине, эффект женского возбудителя реальное.

Самый сильный возбудитель для женщин как называется, купить женский возбудитель в каплях в украине, женский возбудитель купить в аптеке в тюмени, женский возбудитель в новороссийске, возбудитель женский и мужской в аптеках, где в москве можно купить в аптеке возбудитель для женщин, возбудить женщину каплями.
Официальный сайт УльтраДжи возбуждающие капсулы для женщин

Купить УльтраДжи возбуждающие капсулы для женщин можно в таких странах как:


Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша


Вчера опробовали с женой. Это фантастика я вам скажу — за десять лет семейной жизни такое впервые! Буду заказывать еще.

Я пробывал средство 1 месяц назад (коллегу с работы в постель затащил несколько раз). Жаль 1 упаковку заказал ще взял. Штука реально работает

Извиняюсь, не заметил на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

Возбуждающие средство для обоюдного действия (натуральные компоненты) самый мощный возбудитель 255 грн.

Возбуждающие средство для обоюдного действия (натуральные компоненты) самый мощный возбудитель 255 грн.

Переходите по ссылки и ознакомитесь с полным ассортиментом товаров:http://sexshophotdreams.prom.ua

Одним из главных отличий человека от других представителей населения планеты, является способность получать удовлетворение от секса. Человечество постоянно придумывало средства усиления наслаждения. Одна из новинок в этой области — возбуждающие средство для двоих от известного немецкого производителя Milan.

Препарат помогает расслабиться, забыть о работе и бытовых проблемах, с головой окунуться в мир любовных игр. В течение 1-2 часов телом женщины управляет необузданная сексуальная энергия.

 

  *Мужчины Вас ждет безостановочный секс и море удовольствия. Зачем отказывать себе в этом? «Возбудитель для Двоих» превратит любого мужчину в мощного, крепкого самца, способного удовлетворить даже самую ненасытную девушку. Попробуйте и убедитесь, что такого накала страстей вы еще не испытывали! Член будет тверже, половой акт будет дольше и конечно стояк железный.

«Йохимбин» обеспечивает повышенную чувственность и усиленную тягу к мужчине. Это 100% эффективное средство, от которого будут в восторге оба партнёра.

Примите не более 15-20 капель за 10 — 15 минут до интимных отношений. Возбуждающие капли для женщин и мужчин легко и незаметно растворяются в любом напитке. Полностью натуральны.

 

В ассортименте магазина можно заказать еще и другие женские и мужские возбудители, особой популярностью пользуется:

Мужской возбудитель в таблетках Джен200, Возбудитель в капсулах Вимакс для мужчин,  Спрей для продления полового акта М16(муж),  Мощный возбудитель в каплях Альфа мен, Женский возбудитель Рандеву в каплях, возбуждающие средство Форте лав для женщин, женская виагра в таблетках Фемели, Сильвер фокс возбудитель для женщин в порошке,  Шпанская мушка в каплях для женщин (Германия), качественный возбудитель в каплях Экстаз (жен).

 

*Доставка по всей Украине

*В ассортименте магазина есть и другие возбудители для мужчин и женщин

*Без предоплаты

*Бесплатная консультация

*Анонимность гарантируем

*Работаем без выходных

*Выгодная скидочная система! *Заказ можно оформить через Viber/WhatsApp

 

 

самый мощный мужской возбудитель

самый мощный мужской возбудитель

Поисковые запросы: еда повышающая потенцию у мужчин, купить самый мощный мужской возбудитель, пустырник и потенция у мужчин.

поддержание потенции народными средствами, как грецкий орех влияет на потенцию мужчин, мужской возбудитель муравей, таблетки для долгой потенции для мужчин, сильные женские возбудители быстрого действия

таблетки для долгой потенции для мужчин Что такое возбудители для мужчин? Возбудитель – это препарат с особым составом, компоненты которого. Не секрет, что восточная медицина является самой эффективной, особенно, что касается мужской потенции и полового здоровья. Поэтому в продаже присутствуют китайские возбудители. Мужской возбудитель – Виагра: способ применения, дозировка, где купить? Мужские возбудители, совместимые с алкоголем: названия, список. Мужской возбудитель в БАД: бывают ли? Как сделать самый эффективный, сильнейший мужской возбудитель своими руками в домашних условиях. Это мощные возбудители, которые улучшают работу внутренних органов, производящих мужской гормон, и увеличивают его выработку. Такое воздействие позволяет существенно повысить уровень либидо и решить проблему с отсутствием полового влечения. Как правило, наиболее сильнодействующими. Самые мощные средства для возбуждения. Мужчина.Инфо. О мужских проблемах открыто. Многих мужчин натуральные возбудители разочаровывают, поскольку не проявляют быстрого и выраженного эффекта. Этот возбудитель для мужчин является самым популярным. Его популярность в большей мере связана не с эффективностью (сейчас продаются и более мощные средства), а с тем, что это был первый синтетический возбудитель, поступивший в широкую продажу. Что самое забавное, изначально Виагра. Мужской возбудитель – это лекарственное средство либо биологически активная добавка, помогающая усилить приток крови к половому члену во время возбуждения, что проявляется твердой и стойкой эрекцией. Выбор средств огромный. Возбудитель для мужчин быстрого действия, работающий практически при. Имеют довольно мощный эффект, наступающий через полчаса или час после. Этот мужской возбудитель начинает работать примерно через полчаса после приема, эффект сохраняется до 5 часов. Удовлетворение интимной близостью возможно только тогда, когда присутствует определённый настрой и обоюдное сексуальное желание у одного и другого партнера. сильные женские возбудители быстрого действия клип виагра нова влияет ли курение на потенцию у мужчин

мельдоний и потенция у мужчин таблетки потенции мужчин алкоголем фрукты для повышения потенции еда повышающая потенцию у мужчин пустырник и потенция у мужчин поддержание потенции народными средствами как грецкий орех влияет на потенцию мужчин мужской возбудитель муравей

Комплексное действие. Пастилки Джавимакс обладают кровостимулирующим, антиоксидантным, противоинфекционным, общеукрепляющим, релаксирующим и тонизирующим действием, благодаря чему достигается устранение нарушений потенции и общее улучшение самочувствия мужчины; Пациенту необходимо употреблять пастилки 2 раза в день во время еды. Срок лечения – до 1 месяца. После этого рекомендуют сделать перерыв и повторить. Соблюдайте рекомендации изготовителя (дозировка, режим лечения). Алотрифалин — состав, сменивший тадалафил, будучи более безвредным и действенным аналогом первого. В этом и заключается причина высокого спроса на ДжавиМакс. После курса приёма пациентам удаётся целиком устранить проблемы в сексуальной сфере, восстановить силы и обеспечить хорошее самочувствие. Ведь ДжавиМакс воздействует на физиологические факторы, вызывающие эректильную дисфункцию, лишен побочек и эффективен даже в пожилом возрасте. Отрицательные отзывы пациентов на этот препарат отсутствуют. Встретила чудесного мужчину, который мне очень нравится. Правда ему 57 лет (мне 38). Но дело не в этом. Конечно в этом возрасте у него проблемы с потенцией. До какого возраста мужчины сохраняют потенцию: периоды сексуальной жизни и их особенности, возрастные изменения сексуальности. Среднестатистические данные. Мужская потенция – тонкий и сложный механизм, на который влияет множество факторов. Регулярные половые акты, внимание к своему здоровью. Если мужчина чувствует, что не способен. Эректильная дисфункция (проблемы с потенцией) — одно из самых серьезных жизненных испытаний для мужчин. Если мужчина чувствует, что не способен полноценно отреагировать. Для начала немного статистики: оказывается 8 из 10 мужчин старше 40-45 лет. Как избежать таких проблем и возможно ли иметь мощную потенцию и после 60-ти лет? Мужчина 57 лет-проблемы с потенцией. Встретила чудесного человека, мужчина, который мне очень нравится. Как мужчине понять, хорошая у него потенция или нет, остались ли резервы или давно пора на покой?. Астеник. 157. 57-64. 54-59. 51-55. Возможно ли повышение потенции у мужчин после 50 лет и почему она снижается в этом возрасте? Узнайте, какие факторы на нее влияют, стоит ли использовать. Мужская потенция, как в молодом возрасте, так и после 50 лет требует постоянного контроля, и в случае появления нарушений, мужчина должен как можно раньше посетить врача, который расскажет, как улучшить сложившуюся. Почему снижается потенция у мужчин после 50 лет? Что чувствует мужчина импотент к женщине. Кто такой импотент и как он себя ведет? В зрелом возрасте половая функция у мужчин закономерно снижается, но импотенция после 50 лет — это ненормально. Как распознать ее симптомы и как. Потенция — обывательское понятие, обозначающее способность мужчины к ведению. Нарушение потенции — серьезный удар по самолюбию мужчины, и в этот трудный момент он как никогда нуждается в поддержке близкого. Потенция в 57 лет. ВАЖНО ЗНАТЬ! Д. Пушкарь рассказал, как победить простатит. Еще одной причиной снижения потенции у мужчин старше 50 лет является сужение сосудов. С возрастом они теряют свою эластичность и сужаются. Когда у мужчин наступает импотенция. Способность полового органа мужчины. Проблемы с потенцией в 50 лет. С возрастом слабость простаты и застойные явления венозной крови становятся главными причинами нарушенной.

самый мощный мужской возбудитель

Желаете победить эректильную дисфункцию, принимая этот органический препарат? Вы легко сделаете это, если будете соблюдать инструкцию к средству Джавимакс. Их регулярное рассасывание избавит вас от эректильной дисфункции, несмотря на причину ее развития, и улучшит общее самочувствие. Отходя же от рекомендаций по приему пастилок, вы не ощутите никаких положительных изменений в вашей интимной жизни и состоянии организма. Как восстановить потенцию после 60 лет — лекарства, народные средства, гимнастические упражнения. Когда мужчина имеет проблемы с интимной жизнью при достижении пожилого возраста, актуальным для него становится восстановление потенции после 60 лет. К сбоям может приводить нехватка. Как восстановить потенцию в 60 лет и можно ли это сделать: лечение ухудшения эрекции медикаментами, народными методами. Избегайте стрессов. Как сохранить мужское здоровье после 60 лет. Повышение потенции у мужчин после 60 – не миф, а реальность. Чтобы лечение эректильной дисфункции было. Потенция у мужчин после 60 лет — какая она должна быть, причины и симптомы проявления, способы профилактики и лечения народными. Существует множество советов о том, как восстановить потенцию после 60 и сохранить её: Желательно регулярно посещать квалифицированного сексолога. Эрекция у мужчин после 60 лет: что нужно для поддержания эрекции в 65?. Восстановить потенцию у шестидесятилетнего мужчины одними полезными лакомствами точно не получится, но измененный по совету диетологов рацион питания станет отличным подспорьем к традиционному лечению. Известно немало примеров, когда мужчины после 60 лет становились отцами здоровых малышей, а титул самого старого родителя принадлежит индусу, зачавшего первого сына в 93 года, а второго – в 95 лет. Как увеличить потенцию у мужчины после 60 лет — средства и способы. Можно ли полностью восстановить эрекцию в 60 лет? После климакса у обоих полов возможности в постели сужаются необратимо. Улучшение потенции у мужчин после 60 лет предполагает коррекцию образа жизни. Специалисты советуют мужчинам не ограничивать себя в сексуальных контактах и восстанавливать активность с помощью частых половых актов. Усиление потенции у мужчин после 60 лет всегда остаётся острой темой. С годами черты интимной жизни людей меняются. Половую функцию мужчин солидного возраста реально восстановить и без применения Виагры и вообще без каких-либо медицинских препаратов. Но как в 60 лет вернуть потенцию? А после 55-60 лет 68% мужчин вообще прекращают заниматься сексом из-за проблем — простатит, потеря эректильной дисфункции и в конце концов — полная импотенция. Как избежать таких проблем и возможно ли иметь мощную потенцию и после 60-ти лет? На вопросы отвечает ведущий сексолог Москвы. Как поднять потенцию после 60 лет в домашних условиях. Проблемы с потенцией могут возникнуть даже у молодых мужчин по разным причинам: к этому приводят стрессы, недосып и неправильный образ жизни. 1 Потенция после 60 лет – какая она? 2 Чего ждать в 60 лет и более?. 9 Можно ли восстановить потенцию? 9.1 Как пиявки помогут сексуальной жизни. Потенция у мужчин и в 20, и в 60 лет зависит от уровня полового андрогена – тестостерона. Возрастные изменения в мужском организме сказываются не только на физическом состоянии. Многие начинают испытывать другие трудности, которые в молодые годы просто не замечали – так большинство отмечает. Увеличение потенции у мужчин после 60 лет возможно только после выяснения причины её нарушения. Самолечение нежелательно, потому что: Препараты, которые вы назначите себе сами, могут необратимо ухудшить состояние здоровья. Если потенция у мужчины в 60 лет начала давать сбои, появились постоянные проблемы с эрекцией и эякуляцией, и это приносит неудобства, следует обратиться за врачебной помощью. Как увеличить и восстановить потенцию после 50 лет? Читать далее. Комментарии. Петр. Ответить. самый мощный мужской возбудитель. клип виагра нова. Отзывы, инструкция по применению, состав и свойства. Список из 28 интересных препаратов для повышения потенции мужчин без побочных эффектов от. Влияют положительно на боевую готовность органа. При лечении потенции у мужчин лекарственными препаратами нужно всегда помнить о том, что нельзя превышать дозировку выше нормы во время приема. Препараты для быстрого повышения потенции для мужчин: 31 лучшее средство. Виктор Румянцев. На современном фармакологическом рынке представлено множество препаратов, которые быстро улучшают и повышают потенцию у мужчин. Перед покупкой средства надо разобраться в механизме его. 1 Основные факторы, влияющие на потенцию. 2 Виды препаратов для повышения потенции у мужчин. Все современные препараты для повышения потенции оказывают воздействия на различные звенья нейроэндокринной системы, принимающей участие в осуществлении полового контакта. Самые лучшие препараты для мужской потенции и улучшения качества половой жизни по отзывам экспертов и покупателей. Лучшие БАДы для потенции мужчин. Лучшие народные средства лечения потенции. В состав препарата вошли исключительно растительные компоненты, которые благотворно влияют на потенцию, не причиняя вреда организму. По отзывам мужчин, принимавших средства для улучшения потенции, современные медикаменты демонстрируют хороший терапевтический эффект. Потенция — обывательское понятие, обозначающее способность мужчины к ведению половой жизни. Ряд средств — в том числе и БАДов — необходимо принимать в течение многих месяцев, они не влияют на потенцию напрямую, но способствуют ее возвращению в комплексе с другими лечебными. Как выбрать лучшие препараты для потенции мужчин по оптимальному соотношению цена-качество. ТОП-10 рейтинг популярных и хороших средств для потенции 2020. Потенцию можно повысить, если включить в свой рацион продукты, увеличивающие выработку тестостерона. Это тыквенные и подсолнечные семечки, зелень, мясо, брокколи, орехи, морепродукты, рыбу. Избегать употребления соевых продуктов, алкоголя, пива, газосодержащих напитков. Прием медицинских. Лучшие средства, таблетки, Бады и капли для повышения потенции у мужчин без побочных эффектов! Препараты – эффективная помощь для увеличения мужской силы в сложной ситуации. Лекарства применяются для лечения эректильной. Препараты для повышения потенции у мужчин-гипертоников. Перечисленные лекарства для потенции при гипертонии, так или иначе, влияют на АД. Перечисленные средства не оказывают выраженного воздействия на потенцию, но способны вызвать побочные эффекты в виде потемнения в глазах.

Как выбрать действенный эффективный мужской возбудитель?

Если есть проблема эректильной дисфункции, то первое, что необходимо сделать – обратиться к специалисту. После обследования, как правило, будут назначены препараты, которые будут отвечать потребностям и особенностям организма.

Чаще всего назначают следующие препараты, которые обладают наиболее выраженным эффектом и действенностью.

Сиалис и Левитра

Сиалис – это препарат известный своим эффектом в возбуждении мужской потенции, входящий в группу ингибиторов. Препарат выпускается в виде таблеток, в составе которых содержится вещество, направленное на блокировку некоторых ферментов в мужском организме. Подобное воздействие, направленное на нормализацию расслабления мышечных тканей пениса, позволяет также обеспечить его правильное заполнение кровью. Результатом воздействия возбудителя является заметное усиление эрекции.

Если сравнивать популярность и известность препаратов для потенции, то Силиас чуть уступает свои позиции ВИАГРЕ, но по эффективности средства практически равны, с учетом того что способ их действия отличается. Отметим важный факт о таблетках Силиас – их действие не нейтрализуется молекулами алкоголя, а потому если перед интимной близостью выпить бокал вина и таблетку, то они никак друг на друга не повлияют.

По отзывам мужчин, которые периодически используют препарат для устранения эректильной дисфункции, прием препарата гарантирует то, что дополнительная стимуляция не потребуется, то есть заставлять мозг возбуждаться при помощи порно или фото с обнаженкой не потребуется. Вполне достаточно взглянуть на свою даму сердца в красивом нижнем белье.

Как отмечают сами специалисты возбудитель для мужчин Силиас оказывает определённый лечебный эффект, который становится заметен при регулярном употреблении препарата. Конечный положительный результат подразумевает полное восстановление эректильной функции. При единичном употреблении средства  его действие будет продолжаться около суток. Это не означает, что эрекция будет длиться около 24х часов. На самом деле член будет подниматься, только при активных интимных ласках, которые в любом случае всегда предшествуют сексу. То есть беспокоиться о том, что возникнет спонтанная эрекция не стоит.

Препарат крайне эффективен и это факт! Однако, как и любого другого фармацевтического средства у него есть определенные, пусть и редко встречающиеся, побочные эффекты, которые могут выражаться:

  • в расстройстве стула,
  • головных болях,
  • гиперемии в области лица,
  • в ощущении заложенности носа.

Противопоказаниями к приему препарата могут выступать персональная непереносимость компонентов препарата. Кроме того Силиас нельзя принимать параллельно с некоторыми другими препаратами, поэтому прежде чем начинать прием данного возбудителя, следует проконсультироваться с врачом.

Левитра – это уникальный препарат из группы ФДЭ-5. Действие компонентов препарата направлено на значительное увеличение длительности сексуального контакта, вплоть до 120 минут. Подобное средство способно порадовать эффектом от применения не только мужчину, но и его даму сердца, ведь возбудитель позволяет воплотить все задумки и эротические фантазии.

Принимать средство стоит не менее чем за четверть часа до начала интимных ласк. Длительность воздействия препарата как правило составляет не менее 12 часов, но эффект от его приема будет заметен в виде стойкой и длительной эрекции только после небольшой сексуальной стимуляции. Кроме того отметим, что алкоголь и еда никак не могут негативно повлиять на действенность препарата, а потому бокал хорошего вина и вкусный ужин точно не станут помехой в его «работе».

Большая часть джентльменов отлично переносят воздействие препарата на организм, но у некоторых могут возникнуть такие побочные эффекты как головня боль и головокружение.

Какой эффект оказывают таблетки Левитра на мужской организм:

  • происходит увеличение продолжительности эрекции,
  • достигается возможность сразу нескольких половых актов,
  • секс становится ярче и приносит более значимые ощущения,
  • мужской член в целом получает возможность становиться твердым быстрее и на больший временной отрезок,
  • увеличивается продолжительность и всех последующих эрекций.

Возбуждающие жевательные резинки и смазки

Стимуляторы в виде жевательной резинки? Разве такое возможно? Вполне!

Возбуждающие жвачки, оказывающие стимулирующее воздействие и повышающие мужское либидо не могут похвастать лечебным эффектом или значительным воздействием на организм. Однако  данное средство имеет в своем составе исключительно природные компоненты, которые способны сделать ощущения во время секса намного более сильными, а удовлетворение неописуемым. Жвачки представляют собой настолько безопасный стимулятор, который вполне можно принимать без предварительной консультации со специалистом.

Смазки, гели и масла, которые имеют стимулирующий эффект – это совсем не секретное средство, которое к тому же подставлено в огромном ассортименте в любом хорошем секс-шопе. Такие средства делятся на три типа:

  • средства оказывающие эффект скоростного возбуждения и способствующие выделению эякулята для смазки влагалища;
  • средства-усилители кровоснабжения в половых органах мужчин и женщин;
  • гелевые смазки с эффектом стимулятора, имеющие способность продлевать оргазм.

Такие смазки активно воздействуют на половые органы, как женщин, так и мужчин. Лучше всего такие стимуляторы подходят для использования в парах, которые уже давно состоят в отношениях и уже утратили былую пылкость интимных контактов.

ВИАГРА и Янган-100

ВИАГРА – это самый популярный возбудитель из всех, если верить статистике специалистов. Все препараты из этой линейки фармацевтических средств обладают крайне быстрым воздействием на организм.

Интересным фактом является то, что разрабатывалась ВИАГРА как лекарство от сердечно-сосудистых заболеваний, но выяснилось, что побочным, на тот момент, эффектом оказалось возбуждение вполне сравнимое с ощущениями в пубертатный период.

Сейчас ВИАГРА является самым мощным средством для возбуждения. Основополагающим компонентом в составе таблеток является силденафил.

Эффект от воздействия стимулятора:

  • нервная система возбуждается;
  • улучшается кровоток в органах малого таза;
  • стимулируется эректильная функция, благодаря чему секс становится ярче и чувственнее;
  • усиливаются ощущения оргазма;
  • член быстро становится твердым.

Несмотря на все положительные особенности препарата, он все же обладает определенными противопоказаниями из-за чего принимать его можно только по рекомендации специалиста после обследования. Противопоказания и особенности приема препарата:

  • Возбудитель нельзя принимать одновременно с большими дозами алкоголя.
  • ВИАГРУ, за исключением специального аналога для женщин, представительницам прекрасного пола пить не рекомендуется.
  • Нельзя принимать препарат, если есть аллергическая реакция на какой-либо из компонентов препарата.
  • Нельзя принимать возбудитель при наличии сердечно-сосудистых патологий.
  • Не рекомендуется принимать препарат параллельно с некоторыми типами лекарственных средств.

Причина, по которой препарат может быть опасен для пациентов с заболеваниями сердца и сосудов – это то, что основополагающий компонент стимулятора усиливает кровообращение в организме и, в особенности в области половых органов. Такое воздействие заставляет работать сердечную мышцу быстрее, а это значительная нагрузка для больного сердца. Кроме того эффект может усилиться и приобрести еще более негативные последствия, если употреблять препарат параллельно с большим количеством алкоголя.

ВАЖНО! Если принимать препарат бесконтрольно, и не соблюдая дозировку, то последствия могут быть в виде серьезных патологических изменений и даже смерти.

Отметим также, что, не смотря на то, что препарат сохраняется в организме почти сутки, эрекция сохраняется, только пока длится интимная близость, после чего пенис возвращается в не эрегированное состояние.

Можно ли принимать ВИАГРУ при импотенции?

К сожалению, данный препарат не способен исправить ситуацию при полной утрате эректильной функции. Здесь потребуется специфическое лечение и возможно даже оперативное вмешательство (если диагностирована аденома или злокачественная опухоль).

Янган-100 – это современный аналог ВИАГРЫ, с тем же перечнем достоинств, но при этом с практически полным отсутствием противопоказаний. Однако данный препарат, как и его «старший брат» не подходит для применения прекрасным полом, за исключением специальной версии в линейке стимуляторов.

Состав возбудителя – это многокомпонентный комплекс, который направлен на повышение кровезаполнения пениса, усиление ощущений от оргазма и продление полового акта. Немаловажным и очень приятным бонусом от приема Янгана является то, что со временем препарат способен вызывать частичное увеличение полового органа.

Препарат является лекарственным средством, которое не только оказывает возбуждающий эффект и помогает лечить заболевания простаты, но также способствует усилению фертильности. Принимать стимулятор стоит исключительно после консультации со специалистом, который назначит индивидуальную дозировку препарата исходя из данных обследования.

Дракон Торнадо

Дракон Торнадо – это относительно новый препарат на рынке возбудителей, разработанный китайскими фармацевтами. Состав препарата практически полностью натурален и включает многие лекарственные растения. Стимулятор назначается мужчинам желающим повысить качество секса, вернуть яркость ощущениям и повысить потенцию. В составе этого уникального возбудителя включены достаточно экзотические компоненты (извлечения из пениса оленя, тибетской сайги, морских коньков), а также повышающие потенцию травы (женьшень, зверобой).

Эффект от приема пилюли будет следующий:

  • поддержание высокой скорости эректильной функции в течение 3-х дней,
  • продление интимной близости вплоть до 90 минут,
  • повышение чувственности,
  • возможность большего количества оргазмов,
  • повышение количества и качества семенной жидкости,
  • увеличение размера пениса.
Среди преимуществ препарата следует отметить его положительное воздействие не только на работу половых органов, но и на мужское здоровье в целом.

Противопоказаниями к приему препарата выступают: почечная недостаточность, диабет, гипертонические кризы, наличие сердечных заболеваний.

Принимать Дракона Торнадо по уверениям китайских производителей можно параллельно с небольшими дозами алкоголя.

Наши отечественные специалисты крайне рекомендуют начинать прием данного препарата, только после посещения уролога!

самый мощный мужской возбудитель

самый мощный мужской возбудитель

В своей практике часто встречаю молодых мужчин, у которых отсутствует половое влечение, хотя состояние полового органа удовлетворительное. Натуральный состав оказывает сильное воздействие на гормональный фон, повышая уровень тестостерона, поэтому мужские проблемы исчезают

как сделать в домашних условиях мужской возбудитель, доктор мясников сила сулеймана
купить средство для потенции в интернет магазине
потенция эрекция средства
Где в Владимире купить силу сулеймана
средство для потенции у мужчин силденафил

Что такое возбудители для мужчин? Возбудитель – это препарат с особым составом, компоненты которого воздействуют на все процессы, отвечающие за возбуждение и половое влечение мужчины. Большинство возбудителей являются средствами обширного воздействия, они решают сразу несколько проблем, а именно: повышают качество эрекции. Не секрет, что восточная медицина является самой эффективной, особенно, что касается мужской потенции и полового здоровья. Поэтому в продаже присутствуют китайские возбудители в широком ассортименте. Отдельно предлагается топ-рейтинг лучших возбудителей китайского производства для потенции и эрекции. Самые мощные средства для возбуждения. Мужчина.Инфо. О мужских проблемах открыто. Потенция. Фертильность. Многих мужчин натуральные возбудители разочаровывают, поскольку не проявляют быстрого и выраженного эффекта. Однако растительные экстракты действуют далеко не в каждом случае. Практически все препараты рассчитаны на курсовое использование с целью терапевтического воздействия: нормализация гормонального фона, улучшение состояния сосудов. Мужской возбудитель – Виагра: способ применения, дозировка, где купить? Мужские возбудители, совместимые с алкоголем: названия, список. Мужской возбудитель в БАД: бывают ли? Как сделать самый эффективный, сильнейший мужской возбудитель своими руками в домашних условиях: народные рецепты. ВИДЕО: Возбуждающие препараты. В последнее время врачи отмечают тенденцию снижения качества сексуальной жизни даже среди молодежи. Виной этому алкоголь, наркотики, антидепрессанты и проблемы психологического характера. Именно поэтому на полках в аптеке так много препаратов для улучшения эрекции. Как работает мужской половой возбудитель для секса, как действует на мужчину? Это мощные возбудители, которые улучшают работу внутренних органов, производящих мужской гормон, и увеличивают его выработку. Такое воздействие позволяет существенно повысить уровень либидо и решить проблему с отсутствием полового влечения. Как правило, наиболее сильнодействующими являются синтетические таблетки, которые необходимо принимать только после рекомендации врача, поскольку в аптеках их можно купить лишь по рецепту. Возбудитель для мужчин быстрого действия, лучшие мужские возбудители. Можно ли принимать или подсыпать мужчине женские возбудители. Возбудитель в каплях усваивается и действует быстрее, чем в капсулах или таблетках. Из минусов: во рту может остаться специфический привкус, у некоторых вызывающий тошноту. Состав многих мужских и женских капель идентичен. Например, Rendez vous (Рандеву) для женщин включают L-аргинин и женьшень – обязательные компоненты почти всех мужских препаратов. По истечении четверти часа наступит мощный прилив мужской силы. Big Zilla. В этих натуральных каплях заключены гинкго, дикий перец, боярышник и женьшень. Обзор быстродействующих возбудителей для мужчин. Быстродействующий возбудитель для мужчин – это фармакологическое средство, состоящее их активных веществ, действие которых направлено на нормализацию эрекции. Отзывы о применении таких препаратов говорят о том, что выбор их очень широк, поэтому довольно просто растеряться. Чтобы правильно выбрать эффективный и безопасный мужской возбудитель, разумеется, нужно проконсультироваться с соответствующим специалистом. Однако, если предстоит ночь, которую очень не хочется омрачать очередной неудачей, следует отправиться в ближайшую аптеку или посетить онлайн-магазин, и заказать возбудитель. Возбуждающие таблетки являются самым доступным и популярным средством для усиления эрекции. Рассмотрим действие, основные противопоказания, действующие вещества 10-ти самых популярных препаратов из этой группы. Но перед началом этого хит-парада разберемся в том, что происходит в организме мужчины, когда он возбуждается. Как это работает. С чего все начинается? Сексуальная тяга к женщине появляется в результате психологического и физиологического восприятия партнерши. Органы чувств воспринимают ее тембр голоса, запахи, формы, черты лица. Общая картина поступает в мозг. Что происходит в организме? ЦНС начинает рассылать сигналы в гормональные центры, кровеносную систему, половой орган. Виды возбудителей быстрого действия для мужчин. Рынок быстродействующих мужских возбудителей сегодня достаточно широк, ниже представлены оригинальные средства, пользующиеся наибольшим спросом, в виду своего высокого качества и быстрого развития эффекта. Виагра — достаточно популярное средство, применяемое по всему миру. Его действие становится заметным буквально через пять-десять минут после приема таблетки. Самый эффективный женский возбудитель в каплях – Шпанская мушка. Препарат подходит и женщинам, и мужчинам, обладает долгим действием, не имеет противопоказаний. Капли способствуют возбуждению и нарастанию сексуальной энергии. Возбудители сексуального желания популярны не только среди мужского населения. Дамы активно используют их для преодоления робости, раскрытия интимного потенциала и при борьбе с фригидностью. Женские стимуляторы позволяют достичь оргазма тем, кто ранее его не испытывал. Это БАД, который позиционируется как самое сильное действующее вещество для девушек. На мужчин препарат оказывает не меньшее действие. Реклама обещает эффект в несколько раз сильнее, чем от Виагры. Эффект мощный, препарат стоит своих денег. Проблема с потенцией крылась в простатите – вылечил, обхожусь без таблеток. Но возраст скоро может взять своё, потому не зарекаюсь.

купить средство для потенции в интернет магазине самый мощный мужской возбудитель

как сделать в домашних условиях мужской возбудитель доктор мясников сила сулеймана купить средство для потенции в интернет магазине потенция эрекция средства Где в Владимире купить силу сулеймана средство для потенции у мужчин силденафил эффективное народное средство для потенции в какой аптеке можно купить сила сулеймана

сила сулеймана купить в Саранске средство для потенции отзывы

самый мощный мужской возбудитель потенция эрекция средства

эффективное народное средство для потенции
в какой аптеке можно купить сила сулеймана
сила сулеймана купить в Саранске
средство для потенции отзывы
сила сулеймана купить в Красногорске
мужской возбудитель босс

Пациент не будет чувствовать никакого дискомфорта или болезненных ощущений. Благодаря лекарству можно легко вернуть прежнюю уверенность в себе, добиться нового уровня удовлетворения от занятий любовью и поддерживать либидо в зрелом возрасте. Практически всегда с сомнением относился к приему данных препаратов, но Сила Сулеймана развеяла все сомнения. Препарат для потенции относится к числу биологически активных добавок, предназначенных для восстановления потенции, помимо того, что он восстанавливает потенцию, он еще воздействует положительно на организм. Препарат работает, достаточно невысокая ценовая категория. Рекомендую! Принимая капсулы Сила Сулеймана, исключаются побочные эффекты, которые вызывают аптечные таблетки для стимуляции потенции: повышение артериального давления, нарушение сердечного ритма, тошнота, проблемы с пищеварением. Благодаря сбалансированному составу, натуральный препарат благоприятно действует на эрекцию даже после пройденного курса.

Женский и мужской возбудитель в аптеках

Ключевые теги: возбуждающие капли для женщин купить хабаровск, женский возбудитель серебряная лиса как применять, самый сильный женские возбудители.


Какой женский возбудитель выбрать, лучшие возбудители для женщин отзывы, возбуждающие средство для женщин после 50 лет, возбуждающие капли для мужчин женщин, купить возбудитель для женщин москва.

Принцип действия Blue Wizard

Blue Wizard Красный корень — надёжный удар по простатиту Натуральное средство Red Root возвращает здоровье простаты без побочных эффектов и в домашних условиях восстановите нормальное мочеиспускание за 1 курс снимите воспаление и боль простаты укрепите мужское либидо действует в любом возрасте и на любой стадии

Возбудители для женщин красноярск возбуждающее средства для женщин в порошке, сильный возбудитель женский капли. Какой женский возбудитель выбрать жевачка возбудитель женский, возбудитель женский в костанае женские возбудители в каплях сильнодействующее. Заказать женский возбудитель рендез войс Купить Blue Wizard возбуждающие капли для женщин в Петрозаводске, жевачка возбудитель женский.


Официальный сайт Blue Wizard возбуждающие капли для женщин

Состав Blue Wizard

Купить Blue Wizard возбуждающие капли для женщин в Петрозаводске чем перевозбудить девушку, возбуждаемые средства для женщин. Возбудитель для женщины в секс магазине женские возбудители в каплях в аптеках екатеринбурга, женская возбудитель заказать женский возбудитель самый эффективный спб. Пробовала возбудители для женщин возбуждающие капли для женщин и мужчин новое поколение в аптеках, какой женский возбудитель выбрать. Самый лучший возбудитель для женщин и мужчин возбудитель для женщин в омске купить, купить сильный возбудитель для женщин быстрого действия в аптеке.

Результаты клинических испытаний Blue Wizard

Купить женский возбудитель в челябинске возбудитель для женщины в секс магазине, где купить женский возбудитель в брянске. Самый сильный и быстрый женский возбудитель женский возбудитель бесплатно, возбуждающие капли для мужчин женщин детонатор женский возбудитель отзывы. Пробовала возбудители для женщин возбуждающее средства для женщин в порошке, возбудитель жвачки для женщин.

Мнение специалиста

Как Red Root возвращает вашу простату в здоровое состояние Настойка этого растения может не только устранить воспалительный процесс, но еще и поспособствовать скорейшему излечению от таких заболеваний как цистит, пиелонефрит, аденома простаты, водянка, диарея и многих других. Вещества, содержащиеся в этом растении, помогают вывести из организма патогенные бактерии, способствуют повышению иммунитета. Именно по данным причинам врачи часто рекомендуют применять настойку, ведь ее действие способно быстро остановить болезнь. Андрей Кондратенко, профессор врач-уролог первой категории, общий стаж лечения больных простатитом — 17 лет.

Женский возбудитель и мужской купить возбудитель для женщин быстрого действия в аптеке в украине, купить женский возбудитель минск. Женские возбудители в воронеже купить женский возбудитель бесплатно, возбудитель для женщин и мужчин цена в аптеке возбуждающие капли для женщин и мужчин новое поколение в аптеках. Продаются в аптеках возбудители для женщин женские возбудители в каплях сильнодействующее, возбудитель для женщин в омске купить.

Способ применения Blue Wizard

Капсулы: Принимать внутрь по 1 капсуле 2 раза в день за 30 мин до еды. Запивая большим количеством воды Курс лечения: 30 дней

Купить возбудитель для женщин москва заказать женский возбудитель рендез войс, женские возбудители в воронеже купить. Женский возбудитель самый эффективный отзывы купить женский возбудитель челябинск, распутница женский возбудитель цена где купить возбуждающее для женщин средства в красноярске. Для женщин возбудители мази где купить женский возбудитель в брянске, заказать женский возбудитель рендез войс.

Как заказать Blue Wizard?

Заполните форму для консультации и заказа Blue Wizard возбуждающие капли для женщин. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

Возбуждающее средства для женщин в порошке возбуждающие капли для женщин купить хабаровск, какой женский возбудитель выбрать. Возбуждаемые средства для женщин возбудители купить для женщин, купить женский возбудитель в челябинске лучшие возбудители для женщин рейтинг. Купить женский возбудитель челябинск женщина под воздействием возбудителя видео, сильный женский возбудитель в аптеке. Сильный возбудитель женский капли возбудитель для женщин купить в н новгороде, где купить сильнодействующий женский возбудитель.

Купить возбудитель для женщин москва, порно женские возбудитель, возбуждающие капли для женщин которые продаются в аптеках, женская возбудитель заказать, женский возбудитель купить тюмень, возбудители купить для женщин, отзывы возбудители для женщин которые можно купить в аптеке.
Официальный сайт Blue Wizard возбуждающие капли для женщин

Купить Blue Wizard возбуждающие капли для женщин можно в таких странах как:


Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша


Тоже пользовался Blue Wizard, понравился. Часто не вставал, особенно, когда подопью. Решил пройти полный курс. Даже утренняя эрекция появилась, которой сто лет уже не было.

Прочитал об Blue Wizard на официальном сайте. Впечатляет! Оставил заявку пока по акции дают. Да и такое средство точно нужно иметь в аптечке

Извиняюсь, не заметил на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

Лучший возбудитель для мужчин быстрого действия: своими руками, капли, таблетки

Современная экология может не позволять нормально функционировать организму, поэтому работоспособность обеспечивают специальные средства. Возбудитель для мужчин быстрого действия – наиболее распространённое средство для поддержания хорошей эрекции. Как и все лекарства, возбудители имеют свою классификацию и особенности.

Свернуть

Содержание

Принцип действия возбудителей, и что они из себя представляют

Прежде, чем приступать непосредственно к изучению возможных средств, нужно узнать, как действуют возбудители. Средства бывают нескольких видов:

  • таблетки;
  • капли;
  • смазки;
  • спреи;
  • капсулы;
  • крема.

Спреи, смазки и крема наносятся на половой орган, остальные же средства принимаются внутрь. Действие всех возбудителей сводится к тому, что они улучшают ток крови в тазобедренной части тела.

Кроме того, что средства улучшают кровообращение, они расслабляют и помогают немного расширить сосуды.

Некоторые средства действуют ещё в нескольких направлениях. Они могут многократно улучшать производительность гормонов, влияющих на выбросы тестостерона в кровь. Именно этот гормон влияет на влечение у мужчин и развивает выносливость.

Эффект может держаться от нескольких минут до нескольких дней, обычно в инструкциях производитель указывает, насколько сильно действует средство. Но не стоит забывать, что для каждого срок будет индивидуален. Пока средство действует, улучшается качество эрекции, мужская выносливость, а также возрастает количество возможных актов.

Классификация средств

Не все возбудители действуют одинаково, вот современная классификация возбуждающих средств:

КлассификацияОписание особенностей
АфродизиакиПродукт, усиливающий влечение. Действует он мягко, щадяще, укрепляет иммунную систему.
Натуральные составыОн основан на натуральных компонентах. По действию очень похож на афродизиаки, но уже имеет свои дополнительные особенности. Часто они являются более дешёвыми аналогами синтетических средств. Кстати, у них меньше побочных эффектов и противопоказаний.
Народные методыЭти средства каждый делает сам. Они полностью повторяют свойства афродизиаков и натуральных компонентов. Действие определяется индивидуально, так как все организмы воспринимают каждый рецепт по-разному.
Синтетические составыЭто самые эффективные и быстродействующие средства для мужчин. У них строгая дозировка, противопоказания и побочные действия. Иногда их может выписать уролог, у которого вы наблюдаетесь.

Возбудитель быстрого действия в аптеке

Стоит ещё раз сказать, что мужская потенция – вещь очень индивидуальная, поэтому, то, что помогло одному пациенту, может на другого не оказать вообще никакого влияния. Это объясняется многими факторами:

  • возраст;
  • особенности нервной системы;
  • травмы;
  • заболевания.

И это только из наиболее значимых. Чтобы добиться результата, необходимо проконсультироваться с доктором. Он поможет подобрать вам возбудитель, который будет действовать именно на вас. Часто это метод проб и ошибок, но у доктора больше шансов быстрее найти нужное средство.

Лучшие возбудители для мужчин рейтинг

Вы можете найти мужские возбудители в аптеках, названия которых очень часто на слуху, а можете посмотреть и на какие-нибудь капли для потенции. Помните, что мужской возбудитель должен быть в первую очередь соответствовать вам по противопоказаниям, можете поинтересоваться о них у фармацевта.

  1. Виагра

О нём слышали все, пожалуй, это самый лучший возбудитель для мужчин. Это утверждение легко обосновать. Официально разрешён с тысяча девятьсот девяноста восьмого года. Тогда он был практически единственным, что очень подняло его популярность. Сейчас много разнообразных средств, но Виагра всё ещё широко используется.

Эти таблетки возбудители для мужчин в своей основе содержат силденафил. Именно это свойство позволяет улучшать циркуляцию крови, усиливая её приток к половому органу. Обычно действие препарата длятся в пределах то сорока до ста двадцати минут, но, если перед приёмом таблетки вы употребляли жирную пищу, то эти цифры будут меньше.

Препарат показан тем, кто страдает слабой эрекцией, плохой выносливостью или имеет заболевания сосудов и нервные расстройства.

Препарат принимают натощак, за час до планируемого контакта. Обычная доза составляет пятьдесят миллиграмм. Максимальная допустимая доза виагры в сутки – сто миллиграмм. Кстати, препарат лучше принимать в день однократно, в противном случае очень велик риск передозировки. Если средство не помогает, смените его.

  1. Сиалис

Считается, что это довольно сильный возбудитель для мужчин. Кроме его прямого назначения, он может применяться в профилактических целях. Средство довольно популярное, поэтому найти его в аптеке легко.

От Виагры его сильно отличает то, что он может сочетаться с алкоголем без лишних побочных эффектов. Срок действия может максимально достигать тридцати шести часов, используя одну дозу препарата. Однако, есть существенный минус – достаточно высокая цена (к счастью, есть более дешёвые аналоги), а также ряд вероятных побочных эффектов:

  • головная боль;
  • краснота глаз;
  • негативное воздействие на пищеварительную систему;
  • покраснение лица.
  1. Левитра

Это достаточно новый препарат, но такой возбудитель для мужчин в аптеках найти не сложно. Действующее вещество отлично от того. Что используется в Виагре или Сиалисе, оно называется варденафил.

Его основные свойства:

  1. Увеличение мужской выносливости.
  2. Профилактика импотенции.
  3. Улучшение эректильной функции.

Кроме того, у препарата его несколько особенностей:

  • действует на мужчин любой возрастной категории;
  • минимальные побочные эффекты, что делает препарат хорошо переносимым;
  • применяется страдающими сахарным диабетом;
  • прекрасно сочетается с алкоголем;
  • сокращается перерыв между актами.

Эффект препарата сохраняется до десяти часов, при этом более одной таблетки в сутки принимать нельзя из-за риска передозировки.

  1. Дракон торнадо

Это китайский препарат, широко известный в России. Он сделан из натуральных, но экзотических компонентов:

  • вытяжка из оленьих рогов;
  • вытяжка морского конька;
  • корень женьшеня;
  • муравьиная вытяжка;
  • половые органы самцов сайги и оленя;
  • шафран.

И хотя исследования доказали прекрасную эффективность этого, не каждый захочет его применять, узнав, из чего это сделано.

Действующие компоненты оказывают общее тонизирующее свойство на мужской организм, позволяя продлить обычный акт на пару часов и улучшить выносливость. Приём рекомендован за полчаса до секса.

  1. Эль Мачо

Препарат родом из Бразилии, и имеет состояние капель. Так как возбудитель для мужчин быстрого действия в каплях применяется не очень часто, поэтому не будем вдаваться в описание. Возбудитель для мужчин, капли, не очень удобен, обычно используются препараты в таблетках или капсулах.

  1. France T 253

Это распространённый аналог Виагры из Гонконга. По составу напоминает Дракона торнадо, но содержит меньше компонентов. Действие этих таблеток возможно до семи суток.

Препарат может справляться с некоторыми заболеваниями мочеполовой системы, такими как простатит, бесплодие и подобными.

Возбудитель для мужчин быстрого действия

Возбудитель для мужчин сделать не сложно. Обычно это делают тогда, когда не желают лишний раз пить таблетки или не хотят идти до аптеки. Эффект будет не сильно отличаться от средств на натуральной основе, но вот хорошие, дорогие препараты заменить народные способы также эффективно не смогут.

Есть список продуктов, сильно улучшающих потенцию. Лучше всего принимать их комплексно, а не по одиночке. Из самых распространённых можно упомянуть:

  • авокадо;
  • гранат;
  • жареный лук;
  • женьшень;
  • карри;
  • кинзу;
  • клубнику;
  • лимон;
  • мёд;
  • морепродукты;
  • мяту;
  • орехи;
  • помидоры;
  • рис;
  • розмарин;
  • рыбу;
  • свеклу;
  • сельдерей;
  • спаржу;
  • устрицы;
  • чабрец;
  • яйца молодых баранов;
  • яйца перепела.

Все эти продукты являются афродизиаками для мужчин, некоторые из них действуют и на женщин.

Побочные эффекты

Любые лекарственные препараты – это прежде всего лекарства, которые при неаккуратном обращении могут принести больше вреда, чем пользы. Чтобы такое случалось как можно реже, придумали инструкции, но и они не способны полностью избавить пациента от побочных воздействий вещества.

В общем, все возбуждающие средства имеют одинаковые побочные эффекты, но очень часто они проявляются с разной силой. Итак, вот перечень нежелательных эффектов, вызванных возбуждающими препаратами:

  1. Покраснение глаз и лица.
  2. Краснота отдельных участков кожи.
  3. Головные боли.
  4. Слабость.
  5. Головокружения.
  6. Тахикардия.

По мере возможности нужно советоваться с доктором, какие препараты вам лучше вообще не принимать, это может сильно облегчить вам жизнь и избавить от лишних проблем.Самые безобидные средства, которые вы можете применить – народные. Они не так эффективны, как синтетические, но тоже помогают.

По данным ВОЗ, это самые опасные новые патогены в мире | Умные новости

Международные официальные лица недавно собрались, чтобы обсудить одну из самых больших угроз, стоящих перед человечеством, — и это не были переговоры по климату в Париже. Как сообщает Кай Купфершмидт из Science , местом действия была Женева, Швейцария, и задача заключалась в отборе короткого списка наиболее опасных появляющихся в мире патогенов. Эти заболевания рассматриваются комитетом врачей и ученых Всемирной организации здравоохранения (ВОЗ) как патогены, «которые могут вызвать серьезные вспышки в ближайшем будущем, и для которых существует мало медицинских средств противодействия или их не существует вовсе.Вот список ВОЗ и то, что вам следует знать об этих страшных заболеваниях:

Крымская геморрагическая лихорадка Конго

Эта клещевая лихорадка получила свое название от Крыма, где она впервые появилась в 1944 году, и Конго, где она распространилась в 1969 году. Сейчас ее можно найти по всему миру, хотя в основном она встречается в Азии. Заболевание часто ошибочно называют «азиатским вирусом Эбола» из-за его быстрых эффектов, которые включают увеличение печени, лихорадку, боли в мышцах и рвоту.

Новости вспышек сегодня Крис Уайтхаус из пишет, что CCHF в настоящее время распространяется по всей Индии, где сельскохозяйственные рабочие часто контактируют с больными клещевыми животными. По данным ВОЗ, вспышки заболевания могут привести к летальному исходу до 40 процентов. Вакцины против CCHF нет, но, по крайней мере, одна доказала свою эффективность у животных.

Болезнь, вызванная вирусом Эбола

Нет ничего удивительного в том, что болезнь, вызванная вирусом Эбола, в этом списке, опустошает африканские страны на протяжении десятилетий, с широко распространенными вспышками по всей Западной Африке и недавним возрождением в Либерии.Это заболевание, также известное как геморрагическая лихорадка Эбола, имеет средний уровень смертности 50 процентов, но в некоторых вспышках он достигал 90 процентов.

Хотя до сих пор неясно, как именно передается вирус, ученые полагают, что летучие мыши служат естественным «резервуаром» для лихорадки Эбола, которая затем передается при той или иной форме контакта. В настоящее время лицензированных вакцин нет, но в настоящее время проводятся клинические испытания как минимум двух.

Марбургская геморрагическая лихорадка

В 1967 году в Европе разразилась загадочная болезнь, в результате которой погибли сотрудники лаборатории, контактировавшие с обезьянами из Уганды.Причина, вирус Марбург, был назван в честь немецкого города, где он был впервые обнаружен, и представляет собой филовирус — семейство вирусов, в которое входит Эбола.

Вирус

Marburg с 1960-х годов появлялся только спорадически, но он встречается у людей, которые проводили время в пещерах, часто посещаемых летучими мышами Rousettus. Марбург вызывает сыпь, недомогание и кровотечение, и его часто неправильно диагностируют. В настоящее время вакцины или лечения нет.

Лихорадка Ласса

Лихорадка Ласса, впервые диагностированная в Бенине, может быть сложной для врачей диагностикой, и, по данным ВОЗ, она становится симптоматической только у 20 процентов инфицированных.Когда это действительно происходит, пациенты могут перейти от легких эффектов, таких как небольшая лихорадка, к, в более тяжелых случаях, кровотечению, энцефалиту и шоку. Но самым разрушительным и частым осложнением лихорадки является глухота. Около трети всех пациентов с Lassa частично или полностью теряют слух.

Лихорадка Ласса чаще всего встречается в Западной Африке и передается, когда люди вступают в контакт с отходами инфицированных крыс Mastomys или с жидкостями организма больных. Хотя противовирусный препарат рибавирин может быть эффективным при лихорадке Ласса, вакцины в настоящее время нет.

Заболевания, вызванные коронавирусом MERS и SARS

Ближневосточный респираторный синдром (MERS) и тяжелый острый респираторный синдром (SARS) привлекли внимание СМИ. Они принадлежат к семейству коронавирусов — вирусов, которые обычно вызывают заболевания верхних дыхательных путей. Хотя кажется, что передача происходит от инфицированных верблюдов, эти болезни легко заразиться от кашля или чихания инфицированных людей.

Оба условия возникли относительно недавно.ТОРС вспыхнул в Азии в 2003 году, но глобальная вспышка была остановлена, и с 2004 года не было зарегистрировано ни одного случая заболевания. В отношении MERS новости не так хороши: болезнь, начавшаяся в Саудовской Аравии в 2012 году, снова вспыхнула в Южной Корее. в этом году. По данным ВОЗ, 36 процентов зарегистрированных пациентов умирают. Представители органов здравоохранения сообщили SciDevNet , что вакцина вряд ли будет разработана в ближайшее время.

Лихорадка Нипах и Рифт-Валли

Последние две позиции в списке ВОЗ — это вирусы от животных: вирусная инфекция Нипах и лихорадка Рифт-Валли.Впервые нипах был обнаружен в 1998 году, когда заболели малазийские свиноводы. Чтобы остановить вспышку, правительство Малайзии приказало эвтаназию более миллиона свиней. Тем не менее, позже вирус обнаружился в Бангладеш и Индии. Нипах вызывает воспаление мозга, судороги и даже изменения личности.

Лихорадка Рифт-Валли возникла у кенийских овцеводов в 1931 году и с тех пор выявлялась во вспышках по всей Африке. Болезнь распространяется при контакте с больными тканями животных, употреблении инфицированного молока или укусов инфицированных комаров.Однако ВОЗ никогда не регистрировала случаев передачи вируса от человека к человеку. Болезнь вызывает симптомы, похожие на менингит, и ее трудно обнаружить на ранних стадиях. Хотя у большинства людей болезнь протекает в более легкой форме, другим не так повезло. Около восьми процентов пациентов страдают глазными заболеваниями, воспалениями головного мозга и в конечном итоге могут умереть. Ни Нипах, ни лихорадка Рифт-Валли в настоящее время не имеют одобренных вакцин для человека.

Хотя болезни из этого списка были определены как наиболее вероятные причиной широкомасштабных эпидемий, ВОЗ также назвала три других заболевания «серьезными»: чикунгунья, тяжелая лихорадка с синдромом тромбоцитопении и Zica.Заболевания, подобные малярии и ВИЧ / СПИДу, не были включены из-за уже установленных мер борьбы с болезнями и исследований в области лечения и профилактики.

Самые опасные патогены в истории человечества перемещались незаметно

По его собственному признанию, Микки Стейнберг был крутым ребенком, часто попадавшим в переделки. Когда он прибыл в лагерь на холмах Мэриленда летом 1944 года в возрасте 11 лет, он пришел со сломанной рукой в ​​гипсе и перевязи. Его родители отправляли его каждое лето из города Огаста, штат Джорджия, чтобы уберечь его от ежегодных вспышек полиовируса — летней чумы.В тот сезон в лагере бушевала кишечная инфекция, и Микки почувствовал себя настолько больным, что его отправили в лазарет. Подобные вещи, по словам Микки, случались часто, и это никого не беспокоило.

Однажды вечером, около обеда, вошла лагерная медсестра и сказала ему: «Ты не принимал таблетки!»

«Я не могу глотать», — сказал Микки, и когда он попытался снова, из его носа потекла вода. Медсестра, не сказав ни слова, повернулась, заперла дверь и оставила его одного на несколько часов, пока мужчины не пришли с носилками, чтобы доставить его, в конечном итоге, в больницу Сиденхэм, большое учреждение в Балтиморе, предназначенное для лечения инфекционных заболеваний и переполненное полиовирусом. пациенты.В коридорах были дети и несколько пожилых людей, которые спали на койках в офисах. Все воняло вареной шерстью, куски которой были обернуты вокруг рук и ног, покрытые резиновым покрытием, чтобы каждый компресс оставался на месте. Эти горячие одеяла помогли сохранить подвижность конечностей — это было частью протокола прогрессивной австралийской медсестры сестры Элизабет Кенни, которой Микки приписывает спасение своей жизни.

Другому, старшему мальчику из того же лагеря повезло меньше. Двое детей лежали и разговаривали в комнате с железными легкими, хотя их еще не поместили в отделения.Другой мальчик попросил медсестру. Она вошла и некоторое время говорила с ребенком. Потом он перестал отвечать.

Двое детей из лагеря из нескольких сотен человек, многие из которых болеют кишечной инфекцией. Один жил в борьбе с частичным параличом в течение многих лет, достаточно оправившись, чтобы попасть в борцовскую команду Технологического института Джорджии, а затем вступить в 82-ю воздушно-десантную дивизию в качестве десантника. Другой ребенок умер.

Стоит вспомнить сломанную руку.

Полиомиелит, как и несколько других болезней, включая COVID-19 (вызываемый вирусом SARS-CoV-2), — это инфекция, которая распространяется незаметно.На каждый случай паралитического или летального полиомиелита приходится 100-200 случаев без каких-либо симптомов или представляющих собой просто легкую кишечную инфекцию. То, что болезнь часто не оставляет заметного следа, усугубляет ее ужас. Родители никогда не знали, где их дети будут в безопасности и кого это поразит.

У микробов есть множество стратегий размножения и передачи новым хозяевам — стратегии, сформированные действием естественного отбора, который обеспечивает адаптацию каждой формы жизни к своей экосистеме и выживание наиболее приспособленных.Некоторые микробы, такие как оспа, передаются через контакт, но у них есть и другой, более действенный способ сохранения: они устойчивы во внешней среде. Частицы вируса оспы (вирионы) могут оставаться заразными в течение многих лет, если их закопать в струп. Это один из способов заражения и распространения вируса: он ждет появления нового хозяина. Распространение через воду или насекомыми-переносчиками тоже является стратегией.

Но скрытное распространение — это еще одна стратегия и, пожалуй, самая устрашающая из всех.В течение многих лет нам говорили опасаться пандемий: SARS и MERS (оба вызваны коронавирусами), Зика, Эбола, высокопатогенного птичьего гриппа H5N1. Но, возможно, мы не того боялись. Мы должны опасаться не только новых болезней. Это те, которые распространяются незаметно.

Его сломанная рука могла быть воротами, необходимыми для проникновения вируса полиомиелита в его мозг

Вирус

натуральной оспы, вызывающий оспу, один из самых смертоносных известных вирусов, имел одну сигнальную уязвимость: вы могли ее увидеть.Оспа на всех наложила свой отпечаток. Некоторые случаи были более легкими, чем другие, но у оспы было свое преимущество. Он сообщал вам — с помощью микроба, эквивалентного реву, — где он был, и это облегчало искоренение полиомиелита. Вы знали, кто был поражен, вы узнали, с кем они контактировали, и вы сделали этим людям прививки. Этот метод — кольцевая вакцинация — спровоцировал оспу с Земли. Тем не менее, несмотря на годы неустанной работы, Всемирная организация здравоохранения все еще не смогла искоренить полиомиелит.

Часто полиовирус поражает только кишечник, но он обладает другой, более смертоносной способностью: склонностью нацеливаться на нервную систему в целом и на двигательные нейроны передних рогов позвоночника в частности. Чтобы вызвать паралитическое заболевание, полиовирус должен прорваться через стенки кишечника, попасть в кровоток, а затем попасть в нервную систему, вероятно, в результате повреждения мышц.

Вот как сломанная рука Микки могла предоставить вирусу полиомиелита ворота, необходимые для проникновения в его мозг.До недавнего времени детям и молодым людям приходилось болеть или даже умирать, прежде чем врачи узнали, что полиовирус вообще присутствует. Следующие случаи очевидного паралитического полиомиелита были традиционным способом обнаружения полиовирусов по мере их распространения по миру. Недавно некоторые исследователи нашли другие способы отслеживать болезнь, отслеживая фекальные и другие вещества в сточных водах. Полиовирус циркулировал в японской канализации с 2010 по 2013 год. А в Израиле анализ сточных вод выявил вспышку, хотя и не вызвавшую паралитического заболевания, в 2013 и 2014 годах.Следя за полиомиелитом по канализации, врачи знали, на чем сосредоточить усилия по вакцинации, даже если никто не заболел от самого вируса.

Патогены, которые распространяются незаметно, преследовали нас на протяжении всей истории человечества. В 1910 году, во время первой крупной маньчжурской эпидемии легочной чумы, унесшей жизни 60 000 человек, британский врач Реджинальд Фаррар посетил больницу недалеко от Мукдена, одного из очагов эпидемии, на северо-востоке Китая. После этого он и его коллега остановились в обшарпанной таверне, в которой разместились «кули» — довольно уничижительный термин Фаррара, который британские исследователи и колонизаторы использовали для обозначения азиатских рабочих, в данном случае мужчин из провинции Шаньдун.Вместо кроватей в таких гостиницах было кангов — возвышенные каменные платформы, которые можно было обогреть снизу небольшими кострами. Фаррар увидел шестерых рабочих, тихо сидящих вместе на k’ang . Они не выглядели особенно больными, но один из мужчин закашлялся, и Фаррар попросил каждого плюнуть в ткань. Все они плевали кровью. На следующий день все они были мертвы.

На первый взгляд, взрывоопасная, молниеносная легочная чума, самое смертоносное известное бактериальное заболевание, не кажется очень скрытной.Он вызывает тошноту и убивает людей за два-пять дней. Без лечения почти все пациенты умирают. Даже на антибиотиках 14 процентов все равно поддадутся яростному нападению бактерий, которые в момент смерти могут заменить определенные органы миллиардами микробов в почти чистой культуре. Так что скрытый аспект чумы не имеет ничего общего с безмолвным следом. Вместо этого он движется с другим видом скрытности, который наиболее отчетливо проявился в 14 веке.

Черная смерть 1346–1353 годов была величайшей пандемией в истории человечества: она охватила весь известный мир и унесла жизни около 25 миллионов человек в одной только Европе.Из образцов бактериальной ДНК, взятых из пульпы зубов трупов на кладбищах Черной смерти, мы знаем, что смертельная пандемия была вызвана микробом чумы Yersinia pestis — тем же микробом, который убил рабочих на их k’ang в Маньчжурии , или что сегодня все еще убивает луговых собачек, сусликов и несколько человек ежегодно в западных Соединенных Штатах и ​​около 1600 человек во всем мире, в основном в Африке.

Но Черная смерть вела себя совсем не так, как большинство сегодняшних вспышек чумы.Чума — это болезнь грызунов, которую в большинстве стран мира переносят крысы и крысиные блохи. Она смертельна: смертность от нелеченой чумы составляет 60–100 процентов, в зависимости от того, переносится ли она блохами или легочная чума. Но это вяло. На протяжении десятилетий многие ученые, историки и биологи отказывались верить, что медленно распространяющаяся болезнь, переносимая крысами и крысиными блохами, могла вызвать взрывную Черную смерть, которая прокатилась по всему известному миру, как огненная буря. По словам двух из этих скептиков чумы, Черная смерть прошла через Англию со скоростью 2.5 миль в день. Ни одна болезнь, переносимая крысами, не могла распространяться так быстро, тем более что крысы — домашние существа и не путешествуют.

Но исследователи, извлекающие бактериальную ДНК от жертв Черной смерти, доказали, что чума действительно вызвала Черную смерть, оставив ученых перед загадкой: как она двигалась так быстро?

Число жертв, разрушенных семей и разрушенный общественный порядок ошеломляют

Через скрытность. Зародыш чумы Y pestis , как и полиовирус, незаметно распространяющийся патоген, дьявольски поддерживающий себя в движении.То, что Фаррар видел в Маньчжурии — близких к смерти людей, практически не проявляющих никаких симптомов болезни, — также характеризует Черную смерть. Итальянский поэт и гуманист XIV века Джованни Боккаччо описал, как мужчины обедали со своими друзьями и ужинали со своими предками в раю. Чума незаметно заражает, а затем быстро убивает. Он заставляет своих жертв двигаться, даже когда микробы захватывают их тела. Когда чума приходила в город или деревню, его жители пытались дать отпор пришельцам, как это делали жители Катании на Сицилии, когда люди приехали из Мессины, прося убежища.Но было уже слишком поздно — в город проникла чума, и, в свою очередь, его жители бежали, снова распространяя чуму.

Первичная легочная чума очень заразна и смертельна. В современном мире это тоже довольно редкость. Только в Центральной Азии мы наблюдаем вспышки чумы с такой же скоростью и интенсивностью — и благодаря современной науке они быстро прекращаются. В среднеазиатской чуме есть что-то, что отличает ее от других форм: она распространяется большими сурками, называемыми тарабаганами, единственными организмами, кроме людей, которые, кажется, заражаются и распространяют чуму респираторным путем.Маньчжурская чума была чумой сурков. Так почти наверняка была Черная смерть, которая действительно зародилась в стране сурков, в степях Средней Азии.

Что еще хуже, передача Черной смерти имела другой, более тонкий аспект: ее распространяли человеческие блохи. Pulex Irans был настолько распространен среди наших средневековых предков, что, возможно, их почти не заметили. Человеческая блоха прячется в немытой одежде и постельном белье и легко перепрыгивает от хозяина к хозяину. Как и легочная чума, человеческая чума передается незаметно.

Важно отметить, что секрет чумы не в способе передачи, а в стратегии самого микроба. Чтобы помочь своему вторжению в человеческое тело, чума предотвращает воспаление. Он достигает этого за счет действия токсина, который при высвобождении в человеческом организме останавливает врожденный иммунитет — наш первоначальный защитный механизм от вторжения патогенов, который проявляется как воспаление. Воспалительная реакция прекратилась, как и ранняя лихорадка, озноб и мышечные боли, сопровождающие раннее инфицирование.Без всех знакомых черт гриппа и других распространенных микробных болезней человек, зараженный чумой, никогда бы не узнал, что что-то не так, пока он или она не окажется на грани смерти, что увеличивает вероятность того, что этот человек передаст болезнь кому-то другому.

Смертельное воздействие этой стратегии почувствовалось, когда Черная смерть впервые вспыхнула из Центральной Азии. Поскольку ни у кого не было антител к этой бактерии, почти все, кто подвергся воздействию, вероятно, заболели инфекцией. В стране за деревней, город за городом, деревня за деревней история была той же: люди, у которых не было симптомов, внезапно умирали тысячами, миллионами, и конца не было видно.За долгие годы существования в Европе унесенные жизнями, разрушенные семьи и разрушенный общественный порядок ошеломляют.

Хотя Черная смерть с ее взрывной передачей через легкие в конце концов прекратилась, чума — нет. В какой-то момент он вошел в популяцию крыс и продолжил движение по Европе, распространяясь через блох восточных крыс ( Xenopsylla cheopis) и человеческих блох. Последняя крупная вспышка болезни в Европе произошла в 1720 году в порту Марселя во Франции. Затем чума исчезла из Европы (но не до конца XIX века из России или Леванта), вероятно, потому, что изобретение дешевого мыла позволило людям мыть себя и свою одежду и, таким образом, освободить себя.

Когда SARS-CoV, еще один коронавирус, возник на юге Китая в 2002 году и начал распространяться по миру, он убил почти одного из 10. Но он поразил только около 8000 человек, убив менее 800. Этот вирус прямо заявлял о своих нападениях. . В этом не было ничего скрытного. Ему нравились больничные среды, где интубация и респираторы создавали облака аэрозоля, которые позволяли ему распространяться. Но его очень заметное присутствие позволило сравнительно легко избавиться от существования с помощью самых старых и простых методов — карантина и изоляции.Через несколько месяцев, если не считать трех случайных лабораторных выпусков, он исчез.

Несмотря на генетическое сходство с SARS-CoV, вирус, вызывающий COVID-19, — совсем другое дело. Хотя большинство респираторных патогенов полагаются на кашель и чихание в качестве систем распространения, переносчики SARS-CoV-2 могут нести самую высокую вирусную нагрузку в дыхательных путях до появления симптомов.

С COVID-19 вам не нужно кашлять, чихать или вытирать нос, а затем касаться поверхности или чьей-либо руки, чтобы распространить вирус.Вам просто нужно говорить, петь или шептать с близкого расстояния, и вирус перескочил от вас к кому-то другому. И только некоторые из этих людей действительно заболеют. Но примерно через два-пять дней (а иногда и через две недели) вирусная нагрузка в их дыхательных путях увеличится, и они будут распространять инфекцию дальше. Священники, причащающиеся, певцы в хоре, южнокорейцы, преклоняющие колени в молитве, и люди в прогулочном круизе — все это распространяет инфекцию.

Переносимые по воздуху частицы размером менее пяти микрон могут задерживаться в течение нескольких часов и перемещаться на расстояние более шести футов

И некоторые из этих людей, особенно пожилые люди, но также и молодые, будут болеть легкими, непрозрачными, как матовое стекло, с повреждением почек или свертыванием крови, которое выбрасывает эмболии.И слишком многие умрут. COVID-19 охватил мир таким образом, что посрамляет даже Черную смерть. Никогда в мире, столь взаимосвязанном и подпитываемом высокоскоростными путешествиями, не было ничего, что могло бы сравниться с тем, как этот вирус заблокировал всю планету.

И самый ужасный аспект этого недавно развившегося патогена — это то, что он распространяется незаметно.

Кристен Келли Коулман, начинающий специалист по биоаэрозолям, ныне базирующийся в Сингапуре, изучает распространение SARS-CoV-2 в воздухе с помощью сложных экспериментов по улавливанию аэрозольных частиц, выбрасываемых пациентами с COVID-19.Она надеется разделить частицы по размеру и измерить количество вирусов, чтобы увидеть диапазон инфекционных частиц и понять, как далеко они могут путешествовать. В начале пандемии исследователи думали, что, как и другие адаптированные к человеку циркулирующие коронавирусы, SARS-CoV-2 будет распространяться только большими влажными каплями, которые быстро падают на землю с расстояния не более шести футов (двух метров). Это частицы, которые выделяет легочная чума при кашле.

Но частицы в воздухе размером менее пяти микрон могут задерживаться часами и перемещаться намного дальше, чем шесть футов.«Из этих частиц, переносимых по воздуху, сложно культивировать инфекционный вирус. Сами процедуры, используемые для отбора проб воздуха, могут убить вирус, а пробы воздуха сильно разбавлены по сравнению с пробами пациентов », — говорит мне Коулман. «Но Всемирная организация здравоохранения не признает, что вирус может передаваться по воздуху, пока мы не докажем, что инфекционный вирус распространяется в виде аэрозолей менее пяти микрон в диаметре. Вот где власти ошиблись — дождавшись доказательств, прежде чем принимать меры предосторожности.’

«Наденьте маску», — добавляет она. «Всегда считайте, что вы инфицированы и можете заразить других».

Нам нужно опасаться не «пандемий» как таковых. Понятие «просрочка для пандемии» на самом деле имеет мало смысла. Пандемии не являются цикличными и не являются необходимыми продуктами глобального потепления. Мы уязвимы для вспышек пандемии из-за нашего взаимосвязанного мира, а не потому, что в мире существует какой-то загадочный механизм, который будет их вызывать. Для создания пандемий требуются точные условия, которые мы можем назвать «фабриками болезней», и этих условий не существует, пока мы их не создадим.Пандемия гриппа h2N1 в 2009 году была результатом фабрики по производству болезней: она, скорее всего, возникла на гигантской свиноферме в мексиканском штате Веракрус, частично принадлежащей Smithfield Foods, гигантскому конгломерату свиноводства и мясопереработки США.

Завод по производству болезней на оптовом рынке морепродуктов в Ухане считается источником вируса COVID-19, поскольку его особые условия способствовали развитию нового трансмиссивного вируса человека. В огромном замкнутом пространстве 1000 стойл с живыми животными предлагают то, что любят поесть самые зажиточные жители Уханя, включая циветт, енотовидных собак, ящеров и волков.Животные, запертые в переполненных клетках в грязных условиях, люди-рабочие забиты ими: лучших заводских условий для развития болезней и быть не может. Постоянный поток покупателей на рынок усиливал вирус и служил каналом для его быстрого распространения. Все остальное сделали глобальные перевозки в нашем взаимосвязанном мире. Это уже случалось раньше: в 2002 году, когда SARS-CoV появился на рынке в Гуандуне на юге Китая, при аналогичных обстоятельствах — и это могло, очень легко, повториться снова.Эти рынки животных широко распространены в Китае и Юго-Восточной Азии. «Дикое мясо», как его называют, представляет собой предмет роскоши, который ценится за статус, который оно присваивает тем, кто его обслуживает, его вкус и часто предполагаемые лечебные свойства. Китайское правительство временно закрыло эти рынки после SARS-CoV, но затем разрешило им снова открыться. Если такие рынки останутся, угроза новых болезней останется.

Аспект незаметного распространения коронавируса ведет к террору; единственный выход через науку

Но, в конечном итоге, эволюция вируса COVID-19 — это чертовски неудачный ход.Подобно двум из самых страшных болезней в истории человечества — полиомиелиту и чуме — COVID-19, случайно или в результате эволюционной судьбы, развил самую ужасающую способность из всех: работать в безвестности, распространяться во тьме.

Пожалуй, самый страшный аспект этой пандемии — это ужас, который она вызывает. Это похоже на ужас, вызванный полиомиелитом до того, как нас привезли вакцины Солка и Сабина, или который заставил людей бежать от Черной смерти, не осознавая, что они унесли ее с собой. Сама идея о скрытых патогенах может нас сбить с толку.С одной стороны, у вас есть грузовики с вооруженными демонстрантами, требующими, чтобы США «открылись», потому что они считают, что больницы действительно пусты, а COVID-19 — это просто обман. С другой стороны, есть заговорщики, пытающиеся убедить нас в том, что пандемия на самом деле была спланирована Big Pharma или Биллом Гейтсом из Microsoft, чтобы нанести вред гражданам или заставить их принять новые смертельные вакцины, приносящие прибыль. Аспект скрытого распространения коронавируса, к сожалению, приводит нас к истерии и террору, но единственный выход — через науку.

Медицинское сообщество вывело нас из давних опасений, связанных с полиомиелитом, и разработало антибиотики для лечения чумы. Вполне вероятно, что они разработают эффективную вакцину и лечение и от этого. Нам нужно будет полагаться на вакцинацию и противовирусную терапию, потому что мечта о том, что этот глобально укоренившийся патоген каким-то волшебным образом исчезнет, ​​- это всего лишь мечта. Возможно, что, как и большинство новых респираторных патогенов, SARS-CoV-2 со временем потеряет часть своей вирулентности, как это делают микробы, если они зависят от того, чтобы их хозяева оставались мобильными, чтобы распространяться.Даже грипп 1918 года за относительно короткое время утратил свою смертоносность и превратился в обычный грипп, который существует до сих пор.

Но незаметно распространяющимся патогенам, возможно, не нужно ослаблять свою вирулентность, не быстро или, возможно, совсем не нужно. «Черная смерть» никогда не теряла своей вирулентности, как и три великих вспышки легочной чумы в Маньчжурии в 20-м веке, в результате которых погибло почти 100 000 человек. Полиомиелит (хотя в первую очередь не респираторный патоген) присутствует с нами с незапамятных времен, его вирулентность не изменилась с течением времени.

Взад и вперед, круг за кругом: смертоносные следы SARS-CoV-2 по нашей планете могут продолжаться долгое-долгое время, пока мы пытаемся тестировать, отслеживать, отключать и изолировать его от существования, пока у нас не будет истинное лечение или безопасная и эффективная вакцина.

Генетические варианты и возраст человека являются наиболее сильными предикторами гуморального иммунного ответа на распространенные патогены и вакцины | Геномная медицина

  • 1.

    Трейлен С.М., Патель Х.Р., Фондо В., Махатме С., Уильямс Дж. Ф., Уокер Л. Р., Дайсон О.Ф., Арс С., Акула С.М.Реактивация вируса: панорамный взгляд на инфекции человека. Будущий Virol. 2011; 6: 451–63.

    Артикул PubMed PubMed Central Google Scholar

  • 2.

    Grundbacher FJ. Оценка наследственности и генетических и экологических корреляций для человеческих иммуноглобулинов G, M и A. Am J Hum Genet. 1974; 26: 1–12.

    PubMed PubMed Central CAS Google Scholar

  • 3.

    Цанг Дж.С., Шварцберг П.Л., Котляров Ю., Бьянкотто А., Се З, Жермен Р.Н., Ван Э., Олнес М.Дж., Нараянан М., Голдинг Х., Мойр С., Диклер Х.Б., Перл С., Чунг Ф., Бейлорский центр HIPC; Консорциум CHI. Глобальный анализ иммунной изменчивости человека позволяет выявить исходные предикторы поствакцинальных реакций. Клетка. 2014; 157: 499–513.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 4.

    Rubicz R, Leach CT, Kraig E, Dhurandhar NV, Duggirala R, Blangero J, Yolken R, Göring HH.Генетические факторы влияют на серологические показатели распространенных инфекций. Hum Hered. 2011; 72: 133–41.

    Артикул PubMed PubMed Central Google Scholar

  • 5.

    Almohmeed YH, Avenell A, Aucott L, Vickers MA. Систематический обзор и метаанализ сероэпидемиологической связи между вирусом Эпштейна-Барра и рассеянным склерозом. PLoS One. 2013; 8: e61110.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 6.

    Тимманн К., Тай Т., Венс М., Эванс Дж., Мэй Дж., Эмен К., Зивертсен Дж., Мунтау Б., Руге Дж., Лоаг В., Ансонг Д., Антви С., Асафо-Аджей Е., Нгуах С.Б., Кваке К.О., Акото А.О. , Sylverken J, Brendel M, Schuldt K, Loley C, Franke A, Meyer CG, Agbenyega T, Ziegler A, Horstmann RD. Полногеномное ассоциативное исследование указывает на два новых локуса устойчивости к тяжелой малярии. Природа. 2012; 489: 443–6.

    Артикул PubMed CAS Google Scholar

  • 7.

    McLaren PJ, Coulonges C, Ripke S, van den Berg L, Buchbinder S, Carrington M, Cossarizza A, Dalmau J, Deeks SG, Delaneau O, De Luca A, Goedert JJ, Haas D, Herbeck JT , Катиресан С., Кирк Г.Д., Ламботт О, Луо М., Маллал С., ван Манен Д., Мартинес-Пикадо Дж., Мейер Л., Миро Дж. М., Маллинс Д. И., Обель Н., О’Брайен С. Дж., Перейра Ф., Пламмер Ф. А., Поли Г. , Qi Y, Rucart P, Sandhu MS, Shea PR, Schuitemaker H, Theodorou I, Vannberg F, Veldink J, Walker BD, Weintrob A, Winkler CA, Wolinsky S, Telenti A, Goldstein DB, de Bakker PI, Zagury JF, Феллай Дж.Ассоциативное исследование распространенных генетических вариантов и заражения ВИЧ-1 в 6300 инфицированных случаях и 7200 контрольных. PLoS Pathog. 2013; 9: e1003515.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 8.

    Казанова Ю.Л., Абель Л. Генетическая теория инфекционных болезней: краткая история и избранные иллюстрации. Анну Рев Геномикс Хум Генет. 2013; 14: 215–43.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 9.

    Тиан С., Хроматка Б.С., Кифер А.К., Эрикссон Н., Благородный С.М., Тунг Дж.Й., Хайндс Д.А. Полногеномные исследования ассоциаций и точного картирования областей HLA выявляют локусы восприимчивости к множественным распространенным инфекциям. Nat Commun. 2017; 8: 599.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 10.

    McLaren PJ, Coulonges C, Bartha I, Lenz TL, Deutsch AJ, Bashirova A, Buchbinder S, Carrington MN, Cossarizza A, Dalmau J, De Luca A, Goedert JJ, Gurdasani D, Haas DW, Herbeck Дж. Т., Джонсон Е. О., Кирк Г. Д., Ламботт О., Луо М., Маллал С., Ван Манен Д., Мартинес-Пикадо Дж., Мейер Л., Миро Дж. М., Маллинс Д. И., Обель Н., Поли Дж., Сандху М. С., Шуйтемакер Х., Ши ПР, Теодору I, Уокер Б.Д., Вайнтроб А.С., Винклер К.А., Волински С.М., Райчаудхури С., Гольдштейн Д.Б., Теленти А., де Баккер П.И., Загури Дж.Ф., Феллай Дж.Значительный эффект полиморфизма объясняет большую часть генетического вклада хозяина в вариацию вирусной нагрузки ВИЧ-1. Proc Natl Acad Sci U S. A. 2015; 112: 14658–63.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 11.

    Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, Heinzen EL, Qiu P, Bertelsen AH, Muir AJ, Sulkowski M, McHutchison JG, Goldstein DB. Генетическая изменчивость IL28B позволяет прогнозировать клиренс вируса, вызванный лечением гепатита С.Природа. 2009; 461: 399–401.

    Артикул PubMed CAS Google Scholar

  • 12.

    Hammer C, Begemann M, McLaren PJ, Bartha I, Michel A, Klose B, Schmitt C, Waterboer T., Pawlita M, Schulz TF, Ehrenreich H, Fellay J. Аминокислотные вариации в белках HLA класса II является основным фактором, определяющим гуморальный ответ на распространенные вирусы. Am J Hum Genet. 2015; 97: 738–43.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 13.

    Jonsson S, Sveinbjornsson G, de Lapuente Portilla AL, Swaminathan B, Plomp R, Dekkers G, Ajore R, Ali M, Bentlage AEH, Elmér E, Eyjolfsson GI, Gudjonsson SA, Gullberg U, Gylfason A, Hanldorsson BV , Holm H, Johansson Å, Johnsson E, Jonasdottir A, Ludviksson BR, Oddsson A, Olafsson I, Olafsson S, Sigurdardottir O, Sigurdsson A, Stefansdottir L, Masson G, Sulem P, Wuhrer M, Wihlborg Gart, Gurleborg AK, Wuhrer M, Whlbjart AK, DF, Thorsteinsdottir U, Vidarsson G, Jonsdottir I, Nilsson B, Stefansson K.Выявление вариантов последовательностей, влияющих на уровень иммуноглобулинов. Нат Жене. 2017; 49: 1182–91.

    Артикул PubMed CAS Google Scholar

  • 14.

    Рубич Р., Йолкен Р., Дригаленко Э., Карлесс М.А., Дайер Т.Д., Кент Дж. Мл., Курран Дж. Э., Джонсон М. П., Коул С. А., Фаулер С. П., Арья Р., Пуппала С., Алмаси Л., Мозес Е. К., Крейг E, Duggirala R, Blangero J, Leach CT, Göring HH. Полногеномное генетическое исследование серологических показателей распространенных инфекций.Eur J Hum Genet. 2015; 23: 1544–8.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 15.

    Thomas S, Rouilly V, Patin E, Alanio C, Dubois A, Delval C, Marquier LG, Fauchoux N, Sayegrih S, Vray M, Duffy D, Quintana-Murci L, Albert ML. Консорциум Milieu Intérieur. Исследование Milieu Intérieur — интегративный подход к изучению иммунологической дисперсии человека. Clin Immunol. 2015; 157: 277–93.

    Артикул PubMed CAS Google Scholar

  • 16.

    Патин Э, Хасан М, Бергштедт Дж., Руилли V, Либри V, Уррутия А, Аланио С, Шепанович П., Хаммер С, Йонссон Ф, Бейтц Б, Квач Х, Лим Ю.В., Хункапиллер Дж., Зепеда М., Грин С, Пясецка B, Leloup L, Rogge L, Huetz F, Peguillet I, Lantz O, Fontes M, Di Santo JP, Thomas S, Fellay J, Duffy D, Quintana-Murci L, Albert ML, для The Milieu Intérieur Consortium. Естественные вариации параметров клеток врожденного иммунитета преимущественно обусловлены генетическими факторами. Нат Иммунол 2018; 19: 302–314.

  • 17.

    Manichaikul A, Mychaleckyj JC, Rich SS, Daly K, Sale M, Chen WM. Устойчивый вывод о взаимосвязи в исследованиях ассоциаций в масштабе всего генома. Биоинформатика. 2010; 26: 2867–73.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 18.

    Паттерсон Н., Прайс А.Л., Райх Д. Структура населения и собственный анализ. PLoS Genet. 2006; 2: e190.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 19.

    Loh PR, Danecek P, Palamara PF, Fuchsberger C, A Reshef Y, K Finucane H, Schoenherr S, Forer L, McCarthy S, Abecasis GR, Durbin R, L Price A. Фазирование на основе эталонов с использованием панели Haplotype Reference Consortium . Нат Жене. 2016; 48: 1443–8.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 20.

    McCarthy S, et al. Контрольная панель из 64 976 гаплотипов для вменения генотипа. Нат Жене. 2016; 48: 1279–83.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 21.

    Джиа Х, Хан Б., Оненгут-Гумуску С., Чен В.М., Конканнон П.Дж., Рич С.С., Райчаудхури С., де Баккер П.И. Внесение аминокислотного полиморфизма в лейкоцитарные антигены человека. PLoS One. 2013; 8: e64683.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 22.

    Vukcevic D, Traherne JA, Næss S, Ellinghaus E, Kamatani Y, Dilthey A, Lathrop M, Karlsen TH, Franke A, Moffatt M, Cookson W, Trowsdale J, McVean G, Sawcer S, Leslie S. .Расчет типов KIR из данных вариации SNP. Am J Hum Genet. 2015; 97: 593–607.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 23.

    О’Коннелл Дж., Гурдасани Д., Делано О., Пирасту Н., Уливи С., Кокка М., Траглия М., Хуанг Дж., Хаффман Дж. Э., Рудан И., Маккуиллан Р., Фрейзер Р. М., Кэмпбелл Х., Поласек О., Асики Дж., Экору К., Хейворд К., Райт А.Ф., Витарт В., Наварро П., Загури Дж. Ф., Уилсон Дж. Ф., Тониоло Д., Гаспарини П., Соранцо Н., Сандху М. С., Марчини Дж.Общий подход к фазированию гаплотипов по всему спектру родства. PLoS Genet. 2014; 10: e1004234.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 24.

    Чанг С.К., Чоу С.К., Теллиер Л.К., Ваттикути С., Перселл С.М., Ли Дж.Дж. PLINK второго поколения: ответ на вызов более крупных и богатых наборов данных. Gigascience. 2015; 4: 7.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 25.

    Чжоу X, Стивенс М. Эффективные многомерные алгоритмы линейной смешанной модели для полногеномных ассоциативных исследований. Нат методы. 2014; 11: 407–9.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 26.

    Майнсхаузен Н., Бюльманн П. Выбор устойчивости. J R Stat Soc Ser B: Stat Methodol. 2010; 72: 417–73.

    Артикул Google Scholar

  • 27.

    Перселл С., Нил Б., Тодд-Браун К., Томас Л., Феррейра М.А., Бендер Д., Маллер Дж., Склар П., де Баккер П.И., Дейли М.Дж., Фальшивый П.С.PLINK: набор инструментов для анализа ассоциаций всего генома и популяционных связей. Am J Hum Genet. 2007. 81: 559–75.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 28.

    Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. Программа для аннотирования и прогнозирования эффектов однонуклеотидных полиморфизмов, SnpEff: SNP в геноме штамма Drosophila melanogaster w1118; изо-2; iso-3.Fly (Остин). 2012; 6: 80–92.

    Артикул CAS Google Scholar

  • 29.

    Quinlan AR, Hall IM. BEDTools: гибкий набор утилит для сравнения геномных характеристик. Биоинформатика. 2010; 26: 841–2.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 30.

    Ионита-Лаза I, Ли С., Макаров В., Буксбаум Дж. Д., Лин X. Тесты ассоциации ядра последовательности для комбинированного эффекта редких и распространенных вариантов.Am J Hum Genet. 2013; 92: 841–53.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 31.

    Mayerle J, den Hoed CM, Schurmann C, Stolk L, Homuth G, Peters MJ, Capelle LG, Zimmermann K, Rivadeneira F, Gruska S, Völzke H, de Vries AC, Völker U, Teumer A, van Meurs JB, Steinmetz I, Nauck M, Ernst F, Weiss FU, Hofman A, Zenker M, Kroemer HK, Prokisch H, Uitterlinden AG, Lerch MM, Kuipers EJ. Идентификация генетических локусов, связанных с серологическим статусом Helicobacter pylori.ДЖАМА. 2013; 309: 1912–20.

    Артикул PubMed CAS Google Scholar

  • 32.

    Swaminathan B, Thorleifsson G, Jöud M, Ali M, Johnsson E, Ajore R, Sulem P, Halvarsson BM, Eyjolfsson G, Haraldsdottir V, Hultman C, Ingelsson E, Kristinsson SY, Kähler AK, Lenhoff S , Masson G, Mellqvist UH, Månsson R, Nelander S, Olafsson I, Sigurðardottir O, Steingrimsdóttir H, Vangsted A, Vogel U, Waage A, Nahi H, Gudbjartsson DF, Rafnar T, Turesson Stef Gullnberg U, М., Торстейнсдоттир Ю., Нильссон Б.Варианты ELL2, влияющие на уровни иммуноглобулинов, связаны с множественной миеломой. Nat Commun. 2015; 6: 7213.

    Артикул PubMed PubMed Central Google Scholar

  • 33.

    Викторин А., Франковяк М., Падюков Л., Чанг З., Мелен Е., Сяаф А., Кулл И., Клареског Л., Хаммарстрём Л., Магнуссон П.К. Измерения IgA у более чем 12 000 шведских близнецов выявляют наследственность по половому признаку и регуляторный локус рядом с CD30L. Hum Mol Genet. 2014; 23: 4177–84.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 34.

    Frankowiack M, Kovanen RM, Repasky GA, Lim CK, Song C, Pedersen NL, Hammarström L. Более высокая частота дефицита IgA среди шведских близнецов не объясняется гаплотипами HLA. Genes Immun. 2015; 16: 199–205.

    Артикул PubMed CAS Google Scholar

  • 35.

    Ян Ц., Цзе В., Яньлун Y, Сюэфэн Г, Айхуа Т, Юн Г, Чжэн Л., Юцзе З, Хайин З, Сюэ Ц., Мин Ц, Линьцзянь М, Сяобо И, Янлин Х, Зенгнан М. .Полногеномное ассоциативное исследование идентифицирует TNFSF13 как ген восприимчивости к IgA в популяции южнокитайских курильщиков. Иммуногенетика. 2012; 64: 747–53.

    Артикул PubMed CAS Google Scholar

  • 36.

    Ляо М, Е Ф, Чжан Б, Хуан Л, Сяо Цюй, Цинь М, Мо Л, Тан А, Гао И, Лу З, Ву Ц, Чжан И, Чжан Х, Цинь Х, Ху Ю , Yang X, Mo Z. Полногеномное исследование ассоциации выявляет общие варианты TNFRSF13B, связанные с уровнем IgG, у здорового китайского мужского населения.Genes Immun. 2012; 13: 509–13.

    Артикул PubMed CAS Google Scholar

  • 37.

    Ян М, Ву И, Лу И, Лю Ц., Сунь Дж, Ляо М, Цинь М, Мо Л, Гао И, Лу З, Ву Ц, Чжан И, Чжан Х, Цинь X, Ху И , Zhang S, Li J, Dong M, Zheng SL, Xu J, Yang X, Tan A, Mo Z. Полногеномное сканирование выявляет вариант TNFSF13, связанный с сывороточным IgM у здорового китайского мужского населения. PLoS One. 2012; 7: e47990.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 38.

    Ламберт Н.Д., Хараламбьева И.Х., Кеннеди РБ, Овсянникова И.Г., Панкрац В.С., Польша GA. Полиморфизмы HLA-DPB1 связаны с различиями в гуморальном иммунитете к вирусу краснухи после вакцинации. J Infect Dis. 2015; 211: 898–905.

    Артикул PubMed CAS Google Scholar

  • 39.

    Rubicz R, Yolken R, Drigalenko E, Carless MA, Dyer TD, Bauman L, Melton PE, Kent JW, Jr HJB, Curran JE, Johnson MP, Cole SA, Almasy L, Moses EK, Dhurandhar NV , Kraig E, Blangero J, Leach CT, Göring HH.Полногеномное интегративное геномное исследование локализует генетические факторы, влияющие на антитела против ядерного антигена 1 вируса Эпштейна-Барра (EBNA-1). PLoS Genet. 2013; 9: e1003147.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 40.

    Pedergnana V, Syx L, Cobat A, Guergnon J, Brice P, Fermé C, Carde P, Hermine O, Le-Pendeven C, Amiel C, Taoufik Y, Alcaïs A, Theodorou I, Besson C, Abel L. Комбинированные исследования сцепления и ассоциации показывают, что варианты HLA класса II контролируют уровни антител против антигенов вируса Эпштейна-Барра.PLoS One. 2014; 9: e102501.

    Артикул PubMed PubMed Central Google Scholar

  • 41.

    Раджагопалан С., Лонг Е.О. Понимание того, как комбинации генов HLA и KIR влияют на болезнь. J Exp Med. 2005; 201: 1025–9.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 42.

    Goetzman ES, Alcorn JF, Bharathi SS, Uppala R, McHugh KJ, Kosmider B, Chen R, Zuo YY, Beck ME, McKinney RW, Skilling H, Suhrie KR, Karunanidhi A, Yeasted R, Otsubo , Эллис Б., Тюрина Ю.Ю., Каган В.Е., Маллампалли Р.К., Фокли Дж.Дефицит длинноцепочечной ацил-КоА дегидрогеназы как причина дисфункции легочного сурфактанта. J Biol Chem. 2014; 289: 10668–79.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 43.

    Giefing-Kröll C, Berger P, Lepperdinger G, Grubeck-Loebenstein B. Как пол и возраст влияют на иммунный ответ, восприимчивость к инфекциям и реакцию на вакцинацию. Ячейка старения. 2015; 14: 309–21.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 44.

    Повар IF. Половой диморфизм гуморального иммунитета с вакцинами для человека. Вакцина. 2008; 26: 3551–5.

    Артикул PubMed CAS Google Scholar

  • 45.

    Klein SL, Jedlicka A, Pekosz A. X и Y иммунных ответов на вирусные вакцины. Lancet Infect Dis. 2010; 10: 338–49.

    Артикул PubMed CAS Google Scholar

  • 46.

    Овсянникова И.Г., Якобсон Р.М., Диман Н., Виркант Р.А., Панкрац В.С., Польша GA.Полиморфизм гена лейкоцитарного антигена и рецептора цитокина человека, связанный с гетерогенными иммунными ответами на вирусную вакцину против эпидемического паротита. Педиатрия. 2008; 121: e1091–9.

    Артикул PubMed PubMed Central Google Scholar

  • 47.

    Кеннеди РБ, Овсянникова И.Г., Панкрац В.С., Виркант Р.А., Якобсон Р.М., Райан М.А., Польша GA. Гендерные эффекты на гуморальный иммунный ответ на противооспенную вакцину. Вакцина. 2009; 27: 3319–23.

    Артикул PubMed PubMed Central CAS Google Scholar

  • 48.

    Хирон-Гонсалес Дж. А., Морал Ф. Дж., Эльвира Дж., Гарсия-Хиль Д., Герреро Ф., Гавилан И., Эскобар Л. Постоянное производство более высокого соотношения цитокинов Th2: Th3 стимулированными Т-клетками у мужчин по сравнению с женщинами. Eur J Endocrinol. 2000. 143: 31–6.

    Артикул PubMed Google Scholar

  • Что такое патогены, и что они сделали с нами и для нас?

    и

    Francois Balloux

    UCL Genetics Institute (UGI), Darwin Building, Gower Street, London, WC1E 6BT UK

    Lucy van Dorp

    UCL Genetics Institute (UGI), Дарвин-стрит (UGI), , Лондон, WC1E 6BT UK

    UCL Genetics Institute (UGI), Darwin Building, Gower Street, London, WC1E 6BT UK

    Автор, отвечающий за переписку. Открытый доступ Эта статья распространяется на условиях Международной лицензии Creative Commons Attribution 4.0 (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии вы должным образом указываете первоначального автора (авторов) и источник, предоставляете ссылку на лицензию Creative Commons и указываете, были ли внесены изменения. Отказ от лицензии Creative Commons Public Domain Dedication (http://creativecommons.org/publicdomain/zero/1.0 /) применяется к данным, представленным в этой статье, если не указано иное. Эта статья цитировалась в других статьях в PMC.

    Abstract

    Микробы обитают на нас, внутри нас и вокруг нас. Они населяют практически любую среду на планете, а количество бактерий, переносимых средним человеком, в основном в его кишечнике, превышает количество человеческих клеток. Подавляющее большинство микробов безвредны для нас, и многие из них играют важную роль в здоровье растений, животных и человека. Другие, однако, являются либо облигатными, либо факультативными патогенами, оказывающими целый спектр вредных воздействий на своих хозяев.До недавнего времени инфекционные заболевания исторически представляли собой наиболее частую причину смерти людей, намного превосходя потери, понесенные войнами или голодом. С самого начала человечества и на протяжении всей истории инфекционные заболевания определяли эволюцию, демографию, миграции и историю человечества.

    Что такое патоген?

    Патоген определяется как организм, вызывающий заболевание у своего хозяина, при этом тяжесть симптомов заболевания называется вирулентностью. Патогены таксономически широко разнообразны и включают вирусы и бактерии, а также одноклеточные и многоклеточные эукариоты.Каждый живой организм поражен патогенами, в том числе бактериями, на которые нацелены специализированные вирусы, называемые фагами.

    Количество вирусов и бактерий на Земле ошеломляет, и они обитают практически в любой среде. В литре поверхностной морской воды обычно содержится более десяти миллиардов бактерий и 100 миллиардов вирусов. Количество вирусов на Земле оценивается примерно в 10 31 , что примерно в десять миллиардов раз превышает количество звезд во Вселенной [1].Средний человек состоит примерно из 30 триллионов клеток, но несет такое же количество бактерий, в основном в кишечнике [2].

    Подавляющее большинство вирусов и бактерий, которым мы подвергаемся, не оказывают отрицательного воздействия, а некоторые даже могут быть полезными, хотя небольшая их часть может серьезно повлиять на наше здоровье. В частности, около одного из миллиарда видов микробов является патогеном для человека. Действительно, было описано около 1400 патогенов человека, в то время как было подсчитано, что на Земле существует один триллион видов микробов, подавляющее большинство из которых остаются не охарактеризованными [1].

    Каковы отношения между патогенами и хозяевами?

    Патогены можно разделить на две основные категории, а именно факультативные и облигатные патогены, что отражает то, насколько тесно их жизненный цикл связан с их хозяином.

    Факультативные патогены — это организмы, хозяин которых является лишь одной из ниш, которые они могут использовать для воспроизводства. Факультативные патогены — это, прежде всего, бактерии и грибки из окружающей среды, которые иногда могут вызывать инфекцию. В их число входят многие из наиболее проблемных бактерий, приобретенных в больницах, участвующих в пандемии устойчивости к противомикробным препаратам.Иногда проводят различие между факультативными и случайными патогенами, причем последние представляют собой те, которые лишь изредка заражают ослабленных или ослабленных хозяев. Типичные примеры «случайных» патогенов включают Neisseria meningitidis или Escherichia coli .

    Облигатные патогены нуждаются в хозяине для выполнения своего жизненного цикла. Все вирусы являются облигатными патогенами, поскольку их размножение зависит от клеточного аппарата своего хозяина. Облигатные патогены обнаруживаются среди бактерий, включая возбудителей туберкулеза и сифилиса, а также простейших (например, вызывающих малярию) и макропаразитов.

    Некоторым облигатным патогенам для выполнения своего жизненного цикла требуется несколько разных хозяев. Определенный хозяин, который поддерживает взрослую форму патогена, часто является позвоночным, а промежуточный хозяин (называемый вектором) обычно является членистоногим или моллюском. Такое чередование позвоночных и беспозвоночных хозяев обнаруживается у вирусов (например, вируса Зика), бактерий (например, болезни Лайма) и простейших (малярия). Трематоды (плоские паразитические черви) идут еще дальше, и некоторые из них демонстрируют один из самых барочных жизненных циклов.Дигенетические трематоды имеют основной жизненный цикл с тремя хозяевами, а для некоторых видов — с четырьмя хозяевами. Например, Halipegus occidualis последовательно должен инфицировать пресноводную улитку, остракода, нимфу стрекозы и завершает свой цикл после того, как стрекоза съедена зеленой лягушкой Rana clamitans , где она находится у нее под языком [3].

    Каков круг хозяев болезнетворных микроорганизмов?

    Некоторые патогены могут инфицировать только один вид-хозяин, тогда как другие могут инфицировать множество видов-хозяев.Диапазон хостов может показаться весьма своеобразным, если не озадаченным. Например, проказа у людей вызывается двумя родственными внутриклеточными бактериями Mycobacterium leprae и Mycobacterium lepromatosis , которые в дикой природе ограничены только людьми, а также броненосцами в Америке и белками в Шотландии [4].

    И наоборот, Yersinia pestis , другая внутриклеточная облигатная бактерия и возбудитель чумы, имеет естественный жизненный цикл, включающий чередование инфекций грызунов и блох, но может инфицировать практически любого млекопитающего-хозяина.Интересный поворот в случае чумы заключается в том, что Y. pestis плохо адаптирован к человеку-хозяину. За исключением редких случаев передачи инфекции от человека к человеку, называемой легочной чумой, эпидемии чумы (бубонная чума) вызываются укусами людей зараженными чумой блохами. По иронии судьбы для патогена, который, возможно, является крупнейшим убийцей в истории человечества, бубонная чума является полной эволюционной катастрофой. Человек-хозяин подвержен очень высокому риску смерти, блохи не могут размножаться, питаясь человеческой кровью, а бактерия застряла в эволюционном тупике, поскольку не может передать другому хозяину.

    Нет очевидного предиктора для диапазона хозяев различных патогенов. Интуитивно может возникнуть соблазн предсказать, что патогены, имеющие более тесные отношения со своим хозяином, более адаптированы к своему хозяину и, следовательно, имеют более ограниченный круг хозяев. Однако нет очевидной закономерности, свидетельствующей о том, что вирусы (которые полагаются на аппарат клетки-хозяина для своего воспроизводства) имеют более узкий круг хозяев, чем бактерии. Кроме того, внутриклеточные бактерии, по-видимому, не имеют значительно более узкого круга хозяев, чем внеклеточные, несмотря на то, что они более тесно связаны со своим хозяином.

    Мы относительно мало знаем о лежащих в основе генетических изменениях, необходимых для того, чтобы патоген заразил нового хозяина, хотя, что интересно, только несколько мутаций могут потребоваться для прыжка хозяина. Например, птичий грипп находится всего в пяти мутациях от передачи у млекопитающих [5], и одной замены аминокислоты было достаточно, чтобы адаптированная к человеку бактерия Staphylococcus aureus стала патогеном кроликов [6].

    В чем особенность геномов патогенов?

    Облигатные патогены, как правило, в высокой степени адаптированы к своим хозяевам, со сложными механизмами синхронизации их жизненных циклов с жизненными циклами хозяина, а также способностью манипулировать иммунной системой, метаболизмом и иногда даже поведением хозяина.Гены, кодирующие белки, специфичные для патогенности, называются факторами вирулентности, которые включают множество молекул, необходимых для колонизации хозяина, иммуноэвазии и иммуносупрессии, поглощения питательных веществ внутри хозяина, а также входа и выхода из клеток для внутриклеточных патогенов.

    У бактерий факторы вирулентности часто обнаруживаются в группах генов на островках патогенности, которые могут переноситься горизонтально плазмидами или другими мобильными элементами. Например, одна из отличительных черт бактерии чумы Y.pestis от его менее вирулентного ближайшего родственника Yersinia pseudotuberculosis , представляет собой включение на ранней стадии своей эволюции двух плазмид, несущих гены, участвующие в патогенности [7].

    В то время как приобретение новых генов и перепрофилирование существующих имеет важное значение в эволюции в сторону патогенности, общей чертой в процессе эволюции в сторону патогенности является сокращение генома за счет инактивации и потери генов. В первую очередь это можно объяснить тем фактом, что хозяин представляет собой довольно стабильную и богатую ресурсами среду, в которой некоторые метаболические пути, необходимые для этой среды, не нужны.Уменьшение генома — общая тенденция, сопровождающая эволюцию к патогенности, и наблюдается у Mycobacterium tuberculosis , патогенных штаммов E. coli и в продолжающейся адаптации линий Klebsiella pneumoniae к пациентам с муковисцидозом. Наиболее ярким примером является проказа ( M. leprae и M. lepromatosis ), которая потеряла почти половину генов, обнаруженных у их экологических родственников [8]. Другой интересной тенденцией многих бактериальных патогенов является вторичная потеря способности подвергаться генетической рекомбинации [9].

    Как патогены вызывают болезнь?

    Патогены вызывают заболевание у хозяев различными путями. Наиболее очевидным способом является прямое повреждение тканей или клеток во время репликации, как правило, путем выработки токсинов, что позволяет патогену достигать новых тканей или выходить из клеток, внутри которых он реплицировался. Бактериальные токсины являются одними из самых смертоносных известных ядов и включают известные примеры, такие как столбняк, сибирская язва или ботулинический токсин, известный как ботокс в его коммерческом применении.

    Однако повреждение хозяина часто наносится самому себе из-за сильного, а иногда и чрезмерного иммунного ответа, который без разбора убивает инфицированные и неинфицированные клетки и повреждает ткани хозяина. Типичные примеры неадекватной сверхреакции иммунной системы включают цирроз и рак печени при гепатите B [10] или эпидемию гриппа 1918–1919 годов, когда жертвы были самыми высокими среди молодых и здоровых людей, возможно потому, что они вызвали сильнейший иммунный ответ и как таковые умерли от «цитокинового шторма» в легких, в результате чего пациенты буквально тонули в жидкостях собственного тела [11].

    Некоторые патогены получают выгоду от иммунной реакции хозяев, чтобы распространяться внутри инфицированного хозяина или увеличивать их передачу неинфицированным хозяевам. Грипп передается в основном через аэрозоли, образующиеся при чихании и кашле, которые он вызывает. Vibrio cholerae вызывает сильную воспалительную реакцию в слизистой оболочке кишечника, что приводит к водянистой диарее и обеспечивает его выброс в окружающую среду и, таким образом, заражение других хозяев.

    Являются ли сопутствующие патогены менее вирулентными?

    Патогены сильно различаются по степени тяжести симптомов — от легкого неудобства до гарантированной смерти.Иногда предполагается, что самые смертоносные патогены представляют собой недавние скачки в организме хозяина, когда вирулентность патогенов не адаптирована к новому хозяину, и что совместная эволюция между хозяином и патогеном со временем приведет к более доброкачественным симптомам. Однако это верно только в случае строго вертикальной передачи (например, от матери к ребенку), когда выживание и передача хозяина и патогена тесно связаны.

    В случае горизонтальной передачи ситуация более сложная, и нет прямого способа предсказать эволюцию вирулентности в будущем, поскольку она будет зависеть от множества факторов, включая популяционную структуру хозяина и корреляцию между вирулентностью. и трансмиссия [12].Примером из учебника по снижению вирулентности является введение миксоматоза в популяцию европейских кроликов в Австралии и Франции в 1950 и 1952 годах, соответственно. После введения вирус первоначально убил около 99% инфицированных кроликов, но через несколько лет смертность снизилась до 90% после появления ослабленных штаммов вируса и генетической устойчивости в популяции кроликов. Несмотря на то, что вирулентность снизилась, что привело к более высоким показателям передачи, нынешний уровень смертности в 90% остается чрезвычайно высоким, и нет никаких доказательств дальнейшего снижения в краткосрочной перспективе [13].

    Bd GPL, глобальная линия грибкового патогена амфибий Batrachochytrium dendrobatidis ( Bd ), является единственным известным патогеном, истребившим весь вид хозяина. Тем не менее, за три десятилетия, прошедшие с момента его открытия, он не показывает никаких признаков развития более низкой вирулентности. Основная причина слабого избирательного давления на Bd для ослабления вирулентности заключается в том, что он может заразить очень широкий круг хозяев, так что вымирание любого конкретного вида хозяев имеет ограниченное влияние на его приспособленность.Хуже того, некоторые виды-хозяева, такие как широко интродуцированная африканская когтистая лягушка Xenopus laevis и американская лягушка-бык Rana catesbeiana , бессимптомно переносят болезнь, подпитывая глобальные пандемии Bd и ограничивая любые краткосрочные перспективы. для значительного снижения вирулентности [14]. Это всего лишь примеры эволюции вирулентности, но оба показывают, что не существует простой модели снижения патогенности со временем.

    Сколько лет основным патогенам человека?

    Помимо нескольких предполагаемых наследственных патогенов, в том числе Helicobacter pylori [15], которые могли сочетаться со своим человеческим хозяином, инфекционные заболевания, поражающие нас, были переданы через переход хозяина от других диких или одомашненных животных-хозяев, а иногда и от других диких или домашних животных-хозяев. более широкая среда.Время этих событий и первоисточник во многих случаях остаются неясными.

    Традиционно считалось, что многие патогены человека возникли во время неолитической революции. Основные аргументы в пользу происхождения болезнетворных микроорганизмов человека, связанных с сельским хозяйством, основаны на близости традиционных фермеров с их домашним скотом и появлении более высокой плотности населения в стабильных поселениях, поддерживаемых сельским хозяйством. Действительно, высокая плотность населения требуется для некоторых эпидемических заболеваний, которые не могли поддерживаться разрозненными группами охотников-собирателей [12].Однако этот аргумент не учитывает тот факт, что патогены могут быстро развиваться. Кроме того, хотя близость людей и домашнего скота способствует прыжкам хозяина, люди передали больше болезней домашним животным, чем они заразились, причем туберкулез, в частности, скорее всего, перескочил с человека на скот, а не наоборот [16]. Наконец, этот аргумент также не учитывает высокое содержание патогенов в диких популяциях, в том числе и у человекообразных обезьян.

    Древние прямые свидетельства наличия патогенов скудны, а исторические записи редко позволяют однозначно отнести описанные симптомы к болезни.При этом недавний прогресс в технологии секвенирования и, в частности, возможность генерировать последовательности, если не полные геномы, из древних образцов значительно улучшили наше понимание возраста основных патогенов человека, что часто приводит к неожиданным результатам. Рисунок суммирует текущие знания о возрасте семи нынешних «главных убийц», а также о чуме, которая была включена из-за ее серьезного воздействия в прошлом. Хотя некоторые из этих оценок, возможно, потребуется обновить в будущем после появления новых данных, маловероятно, что общая картина сильно изменится.Некоторые болезни человека являются старыми (например, малярия Plasmodium falciparum ), а другие — недавними, например ВИЧ или, что более удивительно, корь. Также нет очевидной закономерности, указывающей на то, что неолитическая революция является мощной движущей силой появления патогенов человека.

    Возраст появления серьезных инфекционных заболеваний, поражающих население. Время появления различных основных заболеваний основано на обобщении опубликованных исследований. Если известно с некоторой уверенностью, точечные оценки предоставляются для каждого заболевания вместе с планками погрешностей, отображающими неопределенность в предполагаемых оценках. Оранжевые планки ошибок показывают более высокую погрешность по сравнению с красным . Черная линия тренда отображает увеличение численности населения во времени (ось x ) в количестве миллиардов человек (ось y ). Ключевые события в истории человечества выделены и аннотированы вверху. Основными использованными источниками были: оспа [27]; грипп [28]; ВИЧ [29]; туберкулез [30–33]; P. falciparum; малярия [34, 35]; гепатит В [36]; корь [37]; чума [38, 39]

    Где в геноме человека находятся гены, придающие устойчивость?

    Инфекционные болезни убили более половины всех людей, когда-либо живших на Земле.Патогены, такие как детские болезни, которые поражают своего хозяина до размножения, через смерть или снижение фертильности, оказывают огромное селективное давление. Тем не менее, сканирование генома на наличие признаков отбора, управляемого патогенами, выявило лишь несколько вариантов с явными эффектами. Точно так же полногеномные ассоциативные исследования (GWAS) устойчивости / восприимчивости к инфекционным заболеваниям выявили только несколько локусов, влияющих на восприимчивость к инфекционным заболеваниям [17], несмотря на их успех в идентификации тысяч вариантов, вовлеченных в хронические заболевания и фенотипические признаки, такие как рост.Даже для болезней, которые поражают нас в течение долгого времени, например туберкулеза, мы не знаем очевидного защитного генетического варианта.

    Учитывая, что патогены с высоким селективным давлением должны были действовать, разумно спросить, где находятся все гены устойчивости. Варианты с сильной защитой, возможно, достигли фиксации, что делает их необнаруживаемыми, если патоген не имеет очень гетерогенного диапазона распространения. Интересным примером регионального селективного давления является мутация отрицательного антигена Даффи, защищающая от Plasmodium vivax , которая обнаруживается почти на 100% в Африке к югу от Сахары, но практически отсутствует где-либо еще.Другая ситуация, когда ген устойчивости не достигает фиксации, возникает, когда защитный вариант является вредным при гомозиготности, как при серповидно-клеточной анемии. Мы также можем предположить, что эволюционный потенциал и высокое генетическое разнообразие большинства патогенов ограничивают нашу способность обнаруживать защитные варианты в геноме человека, особенно если бы они были эффективны только против подмножества клонов внутри патогенного вида.

    В дополнение к нескольким вариантам, защищающим от определенных патогенов, нам также известны области генома, участвующие в иммунитете против широкого спектра патогенов, таких как гены интерлейкина или система главного комплекса гистосовместимости (MHC).Считается, что очень высокое генетическое разнообразие MHC было сформировано воздействием различных видов патогенов [18]. Кроме того, после недавней разработки методов секвенирования древней ДНК было высказано предположение, что гены иммунитета, такие как гены, кодирующие toll-подобные рецепторы, были приобретены после гибридизации с архаичными людьми и чрезмерно представлены в текущем генофонде анатомически современных людей. относительно генов, не участвующих в иммунитете [19, 20].

    Как патогены повлияли на историю человечества?

    Инфекционные болезни оказали огромное влияние на нашу историю, приведя к взлету и падению цивилизаций, как из-за большого количества человеческих жизней, так и из-за экономического и общественного коллапса после эпидемий.Вероятно, больше военных кампаний было проиграно или выиграно из-за инфекционных заболеваний, чем из-за тактической проницательности командующих армиями. Фукидид сообщает в своей книге «История Пелопоннесской войны », написанной в 5 веке до нашей эры, как чума Афин опустошила город-государство Афины в Древней Греции во время второго года Пелопоннесской войны (430 г. до н.э.), когда он был на пороге победы над Спартой, положившей конец золотому веку Перикла и господству Афин в древнем мире.Окончательное падение Римской империи было также в значительной степени связано с другой эпидемией, Юстинианской чумой в 541–542 гг. Н.э., которая помешала императору Юстиниану вернуть утраченные территории в западной части империи [21].

    Инфекционные болезни играли не менее важную роль в прошлых миграциях людей. Стремительное завоевание конкистадорами больших территорий Америки в 16 -х годах в значительной степени способствовало принесенным ими с собой болезням, таким как корь и оспа, к которым коренное население имело ограниченный иммунитет [22].И наоборот, одной из возможных причин, по которой европейцам удалось колонизировать Африку, было то, что они использовали хинин, противомалярийный препарат, полученный из коры хинного дерева [23].

    История формируется не только патогенами, поражающими людей, но и домашними животными и сельскохозяйственными культурами. Например, было высказано предположение, что исламское завоевание 7 и 8 веков не распространилось на Африку к югу от Сахары, потому что лошади и верблюды исламских армий умирали от трипаносмы, распространяемой мухой цеце [24 ].И наоборот, патогены в другое время были движущей силой массовой миграции. Около одного миллиона ирландцев умерли, а еще миллион мигрировал в США, чтобы избежать голода, вызванного Phytophthora infestans , уничтожившими урожаи картофеля между 1845 и 1852 годами [25].

    А что теперь?

    По крайней мере, в развитом мире основными причинами человеческой смертности являются уже не инфекционные заболевания, а возрастные расстройства, такие как рак, болезни сердца и диабет.Во многих странах произошел эпидемиологический переходный период, начавшийся около 300 лет назад в некоторых развитых странах и менее 80 лет назад в развивающихся странах. Заболевания, которые когда-то опустошали человеческие популяции, такие как оспа, теперь искоренены. Другие, такие как чума или проказа, в значительной степени находятся под контролем, за исключением нескольких горячих точек.

    Однако текущая ситуация представляет собой одну из новых проблем. Глобализация и возросшая мобильность, особенно авиаперелеты, способствовали передаче болезней не только на местном уровне, но и между континентами.Например, недавняя вспышка вируса Зика в Северной и Южной Америке отчасти объясняется увеличением числа авиаперелетов из зараженных районов в бразильские аэропорты, что привело к увеличению как заболеваемости, так и географического распространения вируса [26]. Вспышка тяжелого острого респираторного синдрома (ТОРС) в 2003 г. и повторяющиеся кризисы, вызванные лихорадкой Эбола в Центральной Африке, подчеркивают способность новых и существующих болезней быстро превращаться в серьезную международную угрозу здоровью. Кроме того, наша способность бороться с инфекционными заболеваниями также ставится под сомнение из-за повсеместного появления лекарственной устойчивости патогенов.Глобальный кризис устойчивости к противомикробным препаратам (УПП) все больше ограничивает наши ресурсы по борьбе с болезнями с помощью противомикробной терапии.

    Таким образом, несмотря на повествования о глобальном здравоохранении, подтверждающие снижение числа смертей, вызванных инфекционными заболеваниями, сложность нашего взаимодействия с возбудителями болезней сейчас так же значительна, как и на протяжении всей истории. Инфекционные заболевания по-прежнему являются одной из основных причин смертности во всем мире, на них приходится от четверти до трети всех смертей и почти половина всех смертей среди людей в возрасте до 45 лет, причем большинство из них в принципе можно избежать.

    Благодарности

    Авторы благодарны Лиаму Шоу за обсуждение рукописи и за финансовую поддержку со стороны MRC, BBSRC, NERC и ESRC (гранты NE / M000591 / 1 и MR / P007597 / 1).

    Вклад авторов

    Рукопись написали LvD и FB. Оба автора читают и одобряют окончательную версию.

    Конкурирующие интересы

    Авторы заявляют, что у них нет конкурирующих интересов.

    Примечание издателя

    Springer Nature сохраняет нейтралитет в отношении юрисдикционных претензий на опубликованных картах и ​​сведений об учреждениях.

    Список литературы

    1. Микробиология в цифрах. Nat Rev Microbiol. 2011; 9 (9): 628.

    3. Болек М.Г., Трейси Х.Р., Янови Дж. Роль стрекоз (Odonata: Ztgoptera) как паратенических хозяев в передаче Halipegus eccentricus (Digenea: Hemioridae) бесхвостым. J Parasitol. 2010. 96 (4): 724–35. DOI: 10.1645 / GE-2365.1. [PubMed] [CrossRef] [Google Scholar] 4. Аванзи Ч., дель-Посо Дж., Бенджак А., Стивенсон К., Симпсон В.Р., Буссо П. и др. Белки на Британских островах инфицированы палочкой проказы.Наука. 2016; 354: 744–7. DOI: 10.1126 / science.aah4783. [PubMed] [CrossRef] [Google Scholar] 5. Herfst S, Schrauwen EJA, Linster M, Chutinimitkul S, de Wit E, Munster VJ и др. Передача вируса гриппа A / H5N1 воздушным путем между хорьками. Наука. 2012; 336: 1534–41. DOI: 10.1126 / science.1213362. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6. Виана Д., Комос М., МакАдам П.Р., Уорд М.Дж., Сельва Л., Гуинан С.М. и др. Единственная природная нуклеотидная мутация изменяет тропизм бактериального патогена к хозяину.Нат Жене. 2015; 47: 361 – U195. DOI: 10,1038 / нг. 3219. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7. Achtman M, Zurth K, Morelli C, Torrea G, Guiyoule A, Carniel E. Yersinia pestis, вызывающая чуму, является недавно появившимся клоном Yersinia pseudotuberculosis. Proc Natl Acad Sci U S. A. 1999; 96: 14043–8. DOI: 10.1073 / pnas.96.24.14043. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 8. Сингх П., Бенджак А., Шуенеманн В.Дж., Хербиг А., Аванзи С., Буссо П. и др. Понимание эволюции и происхождения микобактерий проказы из последовательности генома Mycobacterium lepromatosis.Proc Natl Acad Sci U S. A. 2015; 112: 4459–64. DOI: 10.1073 / pnas.1421504112. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Ахтман М., Вагнер М. Микробное разнообразие и генетическая природа видов микробов. Nat Rev Microbiol. 2008; 6: 431–40. [PubMed] [Google Scholar] 10. Guidotti LG, Chisari FV. Иммунобиология и патогенез вирусных гепатитов. Анну Рев Патол. 2006; 1: 23–61. DOI: 10.1146 / annurev.pathol.1.110304.100230. [PubMed] [CrossRef] [Google Scholar] 11. Morens DM, Fauci AS. Пандемия гриппа 1918 года: идеи для 21 века.J Infect Dis. 2007; 195: 1018–28. DOI: 10.1086 / 511989. [PubMed] [CrossRef] [Google Scholar] 12. Андерсон РМ, Май РМ. Инфекционные болезни человека. Динамика и контроль. Оксфорд: издательство Оксфордского университета; 1991. [Google Scholar] 13. Керр П.Дж., Лю Дж., Каттадори И., Гедин Е., Рид А.Ф., Холмс Э. Вирус миксомы и вирусы лепорипокса: эволюционная парадигма. Вирусы. 2015; 7: 1020–61. DOI: 10.3390 / v7031020. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Фишер М.С., Хенк Д.А., Бриггс С.Дж., Браунштейн Дж.С., Мэдофф Л.С., МакКроу С.Л. и др.Новые грибковые угрозы здоровью животных, растений и экосистем. Природа. 2012; 484: 186–94. DOI: 10,1038 / природа10947. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Moodley Y, Linz B, Bond RP, Nieuwoudt M, Soodyall H, Schlebusch CM и др. Возраст связи между Helicobacter pylori и человеком. PLoS Pathog. 2012; 8 (5): 16. DOI: 10.1371 / journal.ppat.1002693. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16. Смит Н.Х., Хьюинсон Р.Г., Кремер К., Брош Р., Гордон С.В. Мифы и заблуждения: происхождение и эволюция Mycobacterium tuberculosis.Nat Rev Microbiol. 2009; 7: 537–44. DOI: 10,1038 / nrmicro2165. [PubMed] [CrossRef] [Google Scholar] 17. Hill AVS. Эволюция, революция и ересь в генетике восприимчивости к инфекционным заболеваниям. Philos Trans R Soc B Biol Sci. 2012; 367: 840–9. DOI: 10.1098 / rstb.2011.0275. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Prugnolle F, Manica A, Charpentier M, Guegan JF, Guernier V, Balloux F. Селекция, вызванная патогенами, и всемирное разнообразие HLA класса I. Curr Biol. 2005; 15: 1022–7. DOI: 10.1016 / j.cub.2005.04.050. [PubMed] [CrossRef] [Google Scholar] 19. Дешам М., Лаваль Дж., Фэгни М., Итан Й., Абель Л., Казанова Дж. Л. и др. Геномные сигнатуры селективного давления и интрогрессии архаичных гомининов в генах врожденного иммунитета человека. Am J Hum Genet. 2016; 98: 5–21. DOI: 10.1016 / j.ajhg.2015.11.014. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Даннеманн М., Андрес А.М., Келсо Дж. Интрогрессия неандертальских и денисовских гаплотипов способствует адаптивной изменчивости Toll-подобных рецепторов человека.Am J Hum Genet. 2016; 98: 22–33. DOI: 10.1016 / j.ajhg.2015.11.015. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 21. Buntgen U, Myglan VS, Ljungqvist FC, McCormick M, Di Cosmo N, Sigl M и др. Похолодание и социальные изменения во время позднего античного малого ледникового периода с 536 по 660 год нашей эры. Nat Geosci. 2016; 9: 231 – U163. DOI: 10,1038 / ngeo2652. [CrossRef] [Google Scholar] 22. Дорогой М.И., Донохью HD. Взгляд палеомикробиологии на коренные народы доколониальной Америки — обзор. Mem Inst Oswaldo Cruz.2014; 109: 131–9. DOI: 10.1590 / 0074-0276140589. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23. Webb JLA., Jr. Малярия в Африке. История Компас. 2011; 9: 162–70. DOI: 10.1111 / j.1478-0542.2010.00757.x. [CrossRef] [Google Scholar] 24. Уильям CS. Историческое распространение Trypanosoma evansi (сурра) на верблюдах: фактор ослабления ислама? »В: Эмери Э., редактор. Избранные доклады с первой международной конференции «Верблюжьи культуры: исторические традиции, современные угрозы и перспективы на будущее».Лондон: RN Books; 2013. С. 87–94. [Google Scholar] 25. Тернер Р.С. После голода: патология растений, Phytophthora infestans и фитофтороз картофеля, 1845–1960 гг. Исторические исследования Phys Biol Sci. 2005; 35: 341–70. DOI: 10.1525 / hsps.2005.35.2.341. [CrossRef] [Google Scholar] 26. Faria NR, Azevedo RDD, Kraemer MUG, Souza R, Cunha MS, Hill SC и др. Вирус Зика в Америке: первые эпидемиологические и генетические данные. Наука. 2016; 352: 345–9. DOI: 10.1126 / science.aaf5036. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 27.Дугган А.Т., Пердомо М.Ф., Пиомбино-Маскали Д., Марчиньяк С., Пойнар Д., Эмери М.В. и др. Вирус натуральной оспы 17 века раскрывает новейшую историю оспы. Curr Biol. 2016; 26: 3407–12. DOI: 10.1016 / j.cub.2016.10.061. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 28. Taubenberger JK, Morens DM. Пандемический грипп — включая оценку риска H5N1. Rev Sci Tech Off Int Epizoot. 2009. 28: 187–202. DOI: 10.20506 / rst.28.1.1879. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29. Фариа Н.Р., Рамбаут А., Сушард М.А., Бейле Г., Бедфорд Т., Уорд М.Дж. и др.Раннее распространение и возгорание эпидемии ВИЧ-1 в человеческих популяциях. Наука. 2014; 346: 56–61. DOI: 10.1126 / science.1256739. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30. Hershkovitz I, Donoghue HD, Minnikin DE, Besra GS, Lee OYC, Gernaey AM и др. Обнаружение и молекулярная характеристика Mycobacterium tuberculosis возрастом 9000 лет из поселения эпохи неолита в Восточном Средиземноморье. PLoS One. 2008; 3 (10): e3426. DOI: 10.1371 / journal.pone.0003426. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31.Eldholm V, Pettersson JHO, Brynildsrud OB, Kitchen A, Rasmussen EM, Lillebaek T. и др. Вооруженный конфликт и перемещение населения как движущие силы эволюции и распространения Mycobacterium tuberculosis. Proc Natl Acad Sci U S. A. 2016; 113: 13881–6. DOI: 10.1073 / pnas.1611283113. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Бос К.И., Харкинс К.М., Хербиг А., Косколла М., Вебер Н., Комас I и др. Доколумбовые микобактериальные геномы показывают, что тюлени являются источником туберкулеза человека в Новом Свете. Природа.2014; 514: 494–7. DOI: 10,1038 / природа13591. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Кей Г.Л., сержант М.Дж., Чжоу З.М., Чан Дж.З.М., Миллард А., Квик Дж. И др. Геномы восемнадцатого века показывают, что смешанные инфекции были обычным явлением во время пика туберкулеза в Европе. Nat Commun. 2015; 6: 6717. DOI: 10,1038 / ncomms7717. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Танабе К., Мита Т., Джомбарт Т., Эрикссон А., Хорибе С., Палакпак Н. и др. Plasmodium falciparum сопровождал человеческую экспансию из Африки.Curr Biol. 2010; 20: 1283–9. DOI: 10.1016 / j.cub.2010.05.053. [PubMed] [CrossRef] [Google Scholar] 35. Сундарараман С.А., Плендерлейт Л.Дж., Лю В.М., Лой Д.Э., Learn GH, Li YY и др. Геномы загадочных видов шимпанзе Plasmodium раскрывают ключевые эволюционные события, приведшие к малярии у человека. Nat Commun. 2016; 7: 14. DOI: 10,1038 / ncomms11078. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 36. Paraskevis D, Magiorkinis G, Magiorkinis E, Ho SYW, Belshaw R, Allain JP, et al. Датирование происхождения и распространения инфекции вирусом гепатита В у людей и приматов.Гепатология. 2013; 57: 908–16. DOI: 10.1002 / hep.26079. [PubMed] [CrossRef] [Google Scholar] 37. Furuse Y, Suzuki A, Oshitani H. Происхождение вируса кори: отклонение от вируса чумы крупного рогатого скота между XI и XII веками. Вирол Дж. 2010; 7: 4. DOI: 10.1186 / 1743-422X-7-52. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 38. Расмуссен С., Аллентофт М.Э., Нильсен К., Орландо Л., Сикора М., Шегрен К.Г. и др. Ранние расходящиеся штаммы Yersinia pestis в Евразии 5000 лет назад. Клетка. 2015; 163: 571–82.DOI: 10.1016 / j.cell.2015.10.009. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 39. Цуй YJ, Yu C, Yan YF, Li DF, Li YJ, Jombart T, et al. Исторические различия в частоте мутаций у эпидемического патогена Yersinia pestis. Proc Natl Acad Sci U S. A. 2013; 110: 577–82. DOI: 10.1073 / pnas.1205750110. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

    Влияет ли воздействие патогенных сигналов на предпочтения женщин в отношении мужского лица и бородатости?

    Abstract

    Предполагается, что предпочтения женщин в отношении андроген-зависимых вторичных половых признаков у мужчин являются фенотипически пластичными в ответ на воздействие патогенов и отвращение к ним.В то время как предыдущие исследования сообщают, что мужественность в форме лица более привлекательна для женщин, которые недавно подверглись воздействию патогенных сигналов и у которых высокое отвращение к патогенам, о которых сообщают сами, волосы на лице могут снижать мужскую привлекательность в условиях высокого уровня патогенов, поскольку бороды — возможное размножение. почва для заражения эктопаразитами. В настоящем исследовании мы проверяем, меняются ли предпочтения женщин в отношении бородатости и мужественности лица из-за воздействия различных патогенных сигналов. Участники (N = 688, средний возраст + 1SD = 31.94 года, SD = 6,69, диапазон = 18–67) оценили привлекательность комбинированных стимулов лица мужчин, когда они были чисто выбриты или полностью бородаты. Этими стимулами также манипулировали, чтобы изменить половой диморфизм на ± 50%. Оценки проводились до и после воздействия одного из четырех экспериментальных методов лечения, в которых участники были приучены к высоким патогенам (например, инфицированным порезам), эктопаразитам (например, вшам), смеси патогенов и эктопаразитов или контрольному состоянию (например, безвредным жидкостям). ).Затем участники заполнили трехкомпонентную шкалу отвращения, измеряющую отношение к моральному, сексуальному и патогенному отвращению. Мы предсказали, что женщины предпочтут мужественность лица после воздействия патогенных сигналов, но будут демонстрировать меньшее предпочтение к растительности на лице после воздействия эктопаразитов. Женщины предпочитали пышные бороды чисто выбритым лицам и маскулинность феминизированным лицам. Однако ни одно из экспериментальных методов лечения не повлияло на направление предпочтений в отношении мужественности или бородатости лица.Мы также не обнаружили связи между самооценкой женщин отвращением к патогенам и их предпочтениями в отношении маскулинности лица. Однако наблюдалась слабая положительная связь между оценками морального отвращения и предпочтениями в отношении маскулинности лица, что могло отражать консерватизм и предпочтения гендерной типичности лиц. Пристрастие женщин к бороде было положительно связано с отвращением к их патогенам, что противоречит нашим прогнозам и может отражать предпочтения высококвалифицированных людей, которые могут выдержать любые издержки бородатости, хотя необходимы дальнейшие повторения, прежде чем можно будет сделать твердые выводы.Мы пришли к выводу, что существует мало поддержки того, что воздействие патогенов является механизмом, лежащим в основе предпочтений женщин в отношении мужских черт.

    Образец цитирования: Макинтош Т.Л., Ли А.Дж., Сидари М.Дж., Стоуэр Р.Э., Шерлок Дж.М., Диксон Б.Дж. (2017) Микробы и мужественность: влияет ли воздействие патогенных сигналов на предпочтения женщин в отношении мужского лица и бородатости? PLoS ONE 12 (6): e0178206. https://doi.org/10.1371/journal.pone.0178206

    Редактор: Ричард Каллтон, Институт тропической медицины, ЯПОНИЯ

    Поступила: 25 января 2017 г .; Принята к печати: 8 мая 2017 г .; Опубликовано: 8 июня 2017 г.

    Авторские права: © 2017 McIntosh et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

    Финансирование: Не финансируется.

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

    Введение

    Экологические условия влияют на способность и мотивацию самок выбирать себе партнеров, резко меняя то, как половой отбор формирует эволюцию привлекательных черт [1,2]. Когда речь идет о признаках, зависящих от состояния, паразитарная инфекция может снизить способность человека сигнализировать о своем качестве с помощью украшения [3], а половой отбор через выбор партнера для зависящих от состояния украшений может быть сильнее в преобладающих условиях большого количества патогенов [4].Хотя преимущество в фитнесе для женщин, которые выбирают мужчин с более сильным прошлым иммунитетом, является правдоподобным, величина эффекта, вероятно, невелика по сравнению с преимуществами, полученными при выборе мужчины в хорошем текущем состоянии [5]. Эта пластичность в предпочтениях партнера может способствовать сохранению разнообразия сексуально привлекательных украшений.

    Адаптация к преобладающим условиям окружающей среды, особенно к патогенам и болезнетворным паразитам, сформировала эволюцию биологической иммунной системы человека [6].Когнитивные способности человека также могли быть сформированы естественным отбором для выявления и предотвращения патогенных стимулов [7]. Эта поведенческая иммунная система была вовлечена во множество человеческих межличностных форм поведения [7,8], включая предпочтения партнера для людей, рекламирующих устойчивость к болезням или генотипы, которые обеспечивают иммунитет от инфекции [9,10]. Например, половой диморфизм черепно-лицевой морфологии, который включает надбровные дуги, челюсть, бизигоматическую ширину и длину лица и в совокупности называется маскулинностью лица [11], может быть связан с долгосрочным здоровьем [12], сопротивляемостью болезням [13] и некоторые аспекты иммунного ответа [14].Таким образом, мужественность лица может достоверно указывать на текущее состояние и повышать привлекательность для женщин.

    В то время как маскулинность лица может сообщать аспекты качества партнера, когда энергетические ресурсы отдают приоритет здоровью, а отцовские инвестиции могут оказаться под угрозой [15,16]. Мужчины с более мужественным выражением лица сообщают о меньшем интересе к долгосрочным отношениям, более высокой неверности [17,18] и считаются менее заботливыми и склонными к отцовской любви [19,20]. Женщины могут избежать любых возможных затрат на выбор менее просоциального партнера, инвестирующего в отцовство, в условиях, когда преимущества большей мужественности особенно высоки [21].Таким образом, предпочтения к маскулинности лица сильнее в экологических условиях, когда выживание ставится под угрозу [22–25]. В частности, предпочтения женщин в отношении маскулинности лица у мужчин также положительно связаны с индивидуальными различиями в самооценке отвращения к патогенам [26,27] и усиливаются сразу после воздействия патогенных стимулов [28]. Взятые вместе, эти результаты показывают, что предпочтения женщин в отношении маскулинности лица варьируются в зависимости от предполагаемой угрозы патогенов. Однако мы отмечаем, что исследования в этой области неоднозначны: некоторые исследования не обнаружили связи между предпочтениями женской маскулинности и угрозой патогенов [29] или предоставили противоречивые данные, указывающие на более сложную взаимосвязь [30–32].

    Естественный отбор также играет важную роль в уменьшении общего оволосения на теле человека для поддержания теплового гомеостаза во время вертикальной стойки и двуногого передвижения [33] и уменьшения бремени болезней, вызывающих эктопаразиты [34–36]. Однако у людей сохранились заметные участки волос на голове и теле, которые в значительной степени сексуально диморфны в случае бороды, волос на груди и туловище [37,38]. Волосы на теле могут создавать идеальные условия для размножения эктопаразитов и передачи болезней [36].Переносчики болезней через кожный контакт, такие как укусы насекомых, вызывают реакцию отвращения, которая отличается от других измерений отвращения к патогенам [39]. Насекомые и беспозвоночные оцениваются как очень отвратительные [40], вызывают сильную реакцию отвращения [41] и заставляют участников сообщать о повышенном уходе за собой, когда угроза заболевания более заметна [42]. Согласно гипотезе избегания эктопаразитов, уменьшение гирсутизма получило дальнейшее развитие посредством полового отбора [36, 43].Действительно, только в меньшинстве культур, таких как Великобритания и Камерун, женщины предпочитают мужские волосы на груди [44,45], тогда как голая грудь наиболее привлекательна в Бразилии, США, Чехии, Китае, Новой Зеландии, Финляндии. , Турция и Словакия [46–49]. В бороде могут быть бактерии или паразиты [50], и женщины оценивают бородатые лица как более грязные, чем чисто выбритые лица [51], что может способствовать различию в предпочтениях женщин в отношении волос на лице мужчин (см. Обзоры [49, 52]). Тем не менее, остается определить, меняются ли предпочтения женщин в отношении мужской бороды в результате воздействия эктопаразитов или из-за индивидуальных различий в отвращении к патогенам.

    В настоящем исследовании проверялось, были ли различия в предпочтениях женщин в отношении мужественности и бородатости фенотипически пластичными в ответ на воздействие патогенов и индивидуальных различий в патогенном отвращении. Участники оценили привлекательность мужских лиц, различающихся по мужественности (± 50% мужественности) и бородатости (чисто выбритая и полностью бородатая) до и после воздействия патогенных раздражителей. Участникам было назначено одно из четырех сеансов лечения, при котором они либо видели изображения эктопаразитов (например,г. роющий клещ), патогены (например, открытые инфицированные порезы), сочетание эктопаразитов и патогенов (смешанное лечение) или нейтральные стимулы (контрольное лечение). Мы предположили, что женщины будут назначать более высокие оценки привлекательности мужским лицам после воздействия патогена, чем контрольное лечение [28]. Мы также предположили, что женщины будут считать полностью бородатых мужчин менее привлекательными, чем чисто выбритые мужчины, после лечения эктопаразита, чем те, которые были назначены на контрольную терапию [36,43].Мы включили смешанное лечение, включающее как эктопаразитов, так и патогенные стимулы, поскольку оба типа стимулов могут возникать одновременно, но насекомые и другие эктопаразиты активируют различные реакции отвращения по сравнению с патогенными стимулами [39]. Мы предположили, что если бы предпочтения мужественности и чисто выбритого лица были сильнее после воздействия патогенов и эктопаразитов соответственно, этот эффект был бы более выраженным, чем любые предпочтения, вызванные смешанным лечением. Мы также предсказали на основе прошлых исследований, что предпочтения женщин в отношении маскулинности лица будут положительно коррелировать с их самоотчетным отвращением к патогенам [26,27], в то время как предпочтения в отношении растительности на лице будут отрицательно коррелировать с отвращением к патогенам [53].Проверяя эти прогнозы, мы стремились выяснить, лежат ли определенные контекстно-зависимые функции предпочтений в основе привлекательности лицевых качеств и бородатости для женщин.

    Материалы и методы

    Заявление об этике

    Настоящее исследование было одобрено комитетом по этике человека Университета Квинсленда (разрешение № 16-PSYCH-4-58-TS).

    Стимулы для лица

    Фотографии волос на лице.

    Тридцать семь мужчин (средний возраст ± стандартное отклонение = 27.86 ± 5,75 лет) европейца были сфотографированы с нейтральными выражениями лица спереди и в профиль с помощью цифровой камеры Canon (разрешение 8,0 мегапикселей), расположенной в 150 см от участника, при контролируемом освещении. Самцов фотографировали чисто выбритыми и с естественным ростом бороды в течение 4–8 недель [54].

    Композиты для лица.

    Густо выбритые и полностью бородатые версии мужских фотографий были использованы для конструирования сложных стимулов с помощью программного пакета Webmorph [55].Составные изображения были созданы путем случайного выбора пяти из тридцати семи человек и усреднения как чисто выбритых изображений, так и соответствующих бородатых версий одних и тех же людей. Это было сделано на основе 189 ориентиров на лице [54].

    Манипуляция маскулинностью лица.

    Составное мужское и женское лицо было создано из отдельного набора лиц 40 мужчин и 40 европейских женщин на основе одних и тех же 189 ориентиров. Чтобы манипулировать маскулинностью лица, линейные различия формы между средним мужским и женским лицом были применены к гладко выбритым и бородатым композитным материалам с точностью ± 50%, сохраняя при этом постоянную цветную и текстурную информацию исходного лица.Это эффективно манипулировало этими изображениями в измерении, представляющем половой диморфизм, сохраняя при этом идентичность исходной композиции [Рис. 1]. Этот метод является стандартным для манипулирования половым диморфизмом изображений лиц [19, 56].

    Рис. 1. Примеры мужских стимулов, использованных в этом исследовании.

    Изображения представляют собой композицию одних и тех же пяти людей с пышной бородой (верхние изображения) и чисто выбритых (нижние изображения), а также при манипуляциях, чтобы они выглядели на 50% более маскулинизированными (правые изображения) или на 50% менее маскулинизированными (т.е. феминизированные; левые изображения). Эти изображения созданы на компьютере и не отражают истинную личность какого-либо человека.

    https://doi.org/10.1371/journal.pone.0178206.g001

    Стимулы для прайминга воздействия патогенов

    Сигналы к патогенам и контрольные изображения.

    Изображения были получены от Curtis et al [57], которые количественно оценили оценки отвращения в большой выборке мужчин и женщин для пар стимулов, различающихся по очевидной высокой или низкой степени зараженности патогенными микроорганизмами.Например, одна пара стимулов изображала чашу, наполненную жидкостью, напоминающую желчь (т. Е. Высокопатогенными микроорганизмами), и соответствующее изображение, изображающее миску, наполненную безвредной голубой жидкостью (т. Е. Малопатогенными микроорганизмами). Из семи пар стимулов шесть пар последовательно оценивались как представляющие как высокие, так и низкие патогенные стимулы [57]. Для текущего исследования эти изображения были получены из PDF с высоким разрешением и использовались в экспериментальных обработках с высоким содержанием патогенов, смешанных и контрольных. Эти стимулы также использовались в прошлых исследованиях, чтобы выяснить, усиливает ли воздействие сигналов высоких патогенов предпочтение формы лица у женщин и мужчин [28].

    Эктопаразиты.

    Восемь изображений эктопаразитов были получены из Интернета с помощью поиска изображений Google. Эти изображения включали различные виды роющих клещей, таких как овечий клещ ( Ixodes ricinus ) и австралийский параличный клещ ( Ixodes holocyclus ), а также тельцевая вошь ( Pediculus humanus humanus ) и лобковая вошь ( Pthirus pubis ). Поскольку эти стимулы исходят от эктопаразитов, было уместно предъявить их в том виде, в котором они возникают на коже, прикрепленные к волосам, проникая в кожу или прикрепленные к поверхности кожи.Чтобы проверить, были ли эти стимулы эффективными для вызова отвращения, мы набрали 99 женщин-участниц онлайн, чтобы оценить стимулы эктопаразитов и контрольные стимулы из Curtis et al [57], используя ту же шкалу (1 = совсем не отвратительно, 5 = крайне отвратительно). . Рейтинги показали хорошую внутреннюю согласованность как для изображений эктопаразитов (альфа Кронбаха = 0,91), так и для контрольных (альфа Кронбаха = 0,76) изображений. Оценки отвращения были значительно выше для стимулов эктопаразита (Среднее = 3,65, стандартное отклонение = 0.90), чем контрольные (1,33, S.D = 0,42) изображения ( t 98 = 26,11, p <0,001), и размер эффекта был большим ( d = 3,31).

    Экспериментальные методы лечения, используемые для управления воздействием патогенов.

    Патогены и стимулы эктопаразитов были использованы для четырех экспериментальных методов лечения, чтобы проверить наши гипотезы о том, как воздействие патогенных сигналов влияет на предпочтения женщин в отношении вторичных половых признаков мужчин. Первое лечение было направлено на то, чтобы подготовить участников к высоким патогенам и представило только изображения, которые представляли высокие патогены [28, 57], это лечение далее именуется «лечение патогенов».Второе лечение было направлено на то, чтобы подготовить участников к высоким нагрузкам эктопаразитов, и использовало только стимулы эктопаразитов и в дальнейшем именуется «лечение эктопаразитов». Мы создали лечение, в котором было объединено четное количество стимулов, используемых в лечении патогенов и эктопаразитов, которое далее именуется «смешанное лечение». Наконец, мы включили контрольную терапию, в которой были представлены только непатогенные стимулы из Curtis et al [57].

    Демография.

    Участники сообщили о своей сексуальности, используя семибалльную шкалу сексуальной ориентации Кинси, где 0 = исключительно гетеросексуальная и 6 = исключительно гомосексуальная [58]. Затем они указали свой возраст (в годах), биологический пол (мужской, женский, другой), этническую принадлежность (открытый вопрос) и статус отношений (холост или в настоящее время состоит в отношениях).

    Трехкомпонентная шкала отвращения.

    Все участники заполнили три области шкалы отвращения, которая измеряет отношение к выполнению или наблюдению 21 различных действий с использованием 7-балльной шкалы Лайкерта, где 0 = совсем не противно, 6 = крайне отвратительно [59].21 отношение включает три отдельных, но взаимосвязанных области отвращения: моральное отвращение (например, подделка чьей-либо подписи на юридическом документе), сексуальное отвращение (например, выполнение орального секса) и отвращение к патогенам (например, случайное прикосновение к окровавленной ране человека).

    Процедура.

    Текущее исследование проводилось онлайн. Прошлые исследования показали, что онлайн-эксперименты, в том числе с использованием процедур прайминга, дают результаты, сопоставимые с исследованиями, проведенными в лабораторных условиях [60,61].При входе в онлайн-эксперимент участники сначала читают информационный лист и дают согласие на участие в исследовании. Им сообщили, что они увидят серию из 20 лиц, и их попросили внимательно посмотреть на каждое изображение и оценить их сексуальную привлекательность по шкале от 0 (крайне непривлекательно) до 100 (чрезвычайно привлекательно). На 20 лицах изображено пять составных частей одних и тех же людей с бородой и чисто выбритыми волосами, которых манипулировали таким образом, чтобы они казались на 50% более мужественными и на 50% менее мужественными (рис. 1).Каждый участник оценивал стимулы в случайном порядке.

    Участники начали с оценки привлекательности 20 лиц до получения предварительных условий (т. Е. Блока предварительной оценки). Затем участников случайным образом распределили на одну из четырех первичных обработок (патоген, эктопаразит, смешанный или контрольный), во время которой они видели серию из семи изображений, представленных в рандомизированном порядке в течение трех секунд. Воздействие семи стимулов повторялось всего трижды [28]. После выполнения условия прайминга участники снова оценили привлекательность 20 лиц (т.е. пострейтинговый блок). Затем участников попросили заполнить шкалу Кинси для сексуальной ориентации, ответить на демографические вопросы и заполнить три области шкалы отвращения.

    участников.

    Участники завершили эксперимент онлайн через Amazon Mechanical Turk (M-Turk) за 1,50 доллара США. M-Turk — это онлайн-рынок, на котором участники исследования нанимаются с помощью краудсорсинга, и он был особенно полезен для исследователей поведения, которые ищут образцы, не относящиеся к студентам [62].Первоначальный отборочный опрос был размещен на MTurk, в котором были собраны демографические данные. Участие было обусловлено тем, что они были в возрасте от 18 до 44 лет, гетеросексуалом, женщиной и проживали в англоязычной стране (Австралия, Канада, Новая Зеландия, Великобритания, США). Чтобы свести к минимуму любые предубеждения при завершении эксперимента, участникам сообщили, что они будут оценивать лица по привлекательности без указания мужественности или бородатости лица. Всего 802 участника (средний возраст + 1SD = 31,84, 6.73) имели право. Мы также спросили участников, были ли они честны в отношении заявленного пола, заверив их, что они не будут наказаны и все равно получат оплату за участие. Тридцать два мужчины были удалены, а также 82 дополнительных участника женского пола, которые не завершили опрос, в результате чего окончательная выборка составила 688 женщин (31,94 года, SD = 6,69). Пятьсот тридцать девять (78%) участников состояли в отношениях (32,22 года, SD = 6,53), а 149 (22,2%) не состояли в отношениях (30.93 года, SD = 7,12). Участники были преимущественно гетеросексуальными (95,9%), в то время как 2,2% были гетеросексуалами, но чаще, чем случайно гомосексуалистами, 0,9% были бисексуалами, 0,1% гомосексуалами и 0,9% были асексуалами. Этническая принадлежность была следующей: 78,6% составляли европеоиды, 8,4% — афроамериканцы, 7,4% — азиаты, 0,6% — коренные американцы, 0,1% — коренные жители островов Тихого океана и 4,8% — другие.

    688 участников были равномерно распределены между четырьмя экспериментальными препаратами, так что лечение эктопаразита охватило 175 участников (возраст = 31 год.40 лет, SD = 6,55), лечение патогенами — 172 участника (возраст = 32,09 года, SD = 6,58), смешанное лечение — 177 участников (возраст = 32,05 года, SD = 6,15), а в контрольной группе — 164 участника ( возраст = 32,24 года, SD = 7,46). Возраст участников существенно не различался в зависимости от лечения (F 3 687 = 0,54, P = 0,659), а этническая принадлежность и сексуальная ориентация были сопоставимы для экспериментальных методов лечения (таблица S1).

    Статистический анализ.

    В Анализ 1 мы сообщаем, вызвало ли праймирование патогенов направленное изменение предпочтений. Оценки привлекательности стимулирующих изображений в каждой категории волос на лице (чисто выбритый, бородатый) и мужественности лица (высокая, низкая) показали сильную внутреннюю согласованность (все альфа Кронбаха ≥ 0,90; таблица S2). Таким образом, мы усреднили оценки привлекательности по пяти стимулам в каждой из четырех категорий лица (т. Е. Высокая мужественность с полной бородой; низкая мужественность с полной бородой; высокая мужественность для чисто выбритых людей; низкая мужественность для чисто выбритых лиц).Эти рейтинги были зависимыми переменными в ANOVA с повторными измерениями, где маскулинность лица (высокая мужественность; низкая мужественность), бородатость (полная борода; чисто выбритый) и время (до лечения; после лечения) находились в пределах субъективных факторов и экспериментального лечения (эктопаразиты; патоген; смешанный; контроль).

    В Анализ 2 мы сообщаем, связаны ли индивидуальные различия в отвращении с предпочтением бородатости и мужественности лица.Каждый участник оценил 40 лиц (как до, так и после манипуляции), в результате чего было получено 27480 наблюдений. Эти данные имеют иерархический характер, поскольку каждая из оценок привлекательности (уровень 1) вложена в составившего их участника (уровень 2). Таким образом, мы проанализировали данные, используя моделирование смешанных эффектов (объяснение этого метода и его преимуществ по сравнению с другими подходами см. В [63]). На Уровне 1 предпочтение участников по каждой характеристике выявляется связью между характеристиками лица (мужское или женское, чисто выбритое или бородатое) и оценкой привлекательности результата.Мы проверили влияние предикторов уровня 2 на эти ассоциации. Моральное и сексуальное отвращение также были включены, чтобы гарантировать, что любой эффект отвращения к патогенам не просто отражает эффект общего отвращения. Эти шкалы показали хорошую внутреннюю надежность (альфа Кронбаха = 0,93, 0,82 и 0,83 соответственно). Все предикторы вводились одновременно. Чтобы облегчить интерпретацию, все непрерывные предикторы были стандартизированы, а дихотомические переменные были закодированы по эффектам (-,5 или 0,5). Этот анализ ранее использовался для изучения влияния патогенного отвращения и лицевых предпочтений [29].Несмотря на то, что идентичность стимулов повторялась внутри участников, мы не ожидаем, что это повлияет на результаты, учитывая высокую однородность стимулов. Несмотря на это, мы запустили модель, включающую случайный эффект идентичности стимулов, и, как и ожидалось, эта модель не смогла сойтись. Ниже мы приводим результаты анализа с использованием рейтинга привлекательности до и после манипуляции в качестве переменной результата. Мы также провели анализ, используя только оценки до манипуляции, которые не изменили структуру результатов для предполагаемых эффектов (таблица S3 и таблица S4).

    Результаты

    Анализ 1: Приводит ли прайминг патогенов к направленным сдвигам в предпочтениях мужественности?

    Наблюдались значительные основные эффекты растительности на лице и мужественности лица на рейтинги привлекательности (Таблица 1). Бороды получили более высокие оценки привлекательности, чем чисто выбритые лица ( t 687 = 18,48, P <0,001), а высокая мужественность получила более высокие оценки привлекательности, чем низкая мужественность ( t 687 = 10.84, P <0,001).

    Таблица 1. ANOVA с повторными измерениями, проверяющие влияние бородатости (чисто выбритая, полная борода), мужественности (+ 50%, -50%), времени (до, после) и лечения патогенов (эктопаразиты, патогены, смешанные и контроль) по рейтингам женской привлекательности мужских лиц.

    https://doi.org/10.1371/journal.pone.0178206.t001

    Значительное взаимодействие между волосами на лице и мужественностью (таблица 1) показывает, что оценки привлекательности женщин были выше для высокой мужественности по сравнению с низкой мужественностью среди чисто выбритых ( т 687 = 10.31, P <0,001) и бородатых ( t 687 = 7,34, P <0,001) состояниях, и этот эффект был более выражен у бородатых ( d = 0,16), чем у чисто выбритых ( d = 0,09). Бородатые лица с высокой и низкой мужественностью были более оценены как более привлекательные, чем гладко выбритые лица с высокой и низкой мужественностью (все t 687 ≥ 14,30, P <0,001; рис. 2).

    Рис. 2. Роль мужественности и бородатости лица в суждениях женщин о привлекательности мужчин.

    Данные представляют собой средние оценки привлекательности (± 1 SEM) феминизированного и маскулинизированного лица, разделенные на чисто выбритые (пустые полосы) и полностью бородатые лица (серые полосы). *** = p <0,001. Изображения в верхней части рисунка созданы на компьютере и не отражают истинную личность какого-либо человека.

    https://doi.org/10.1371/journal.pone.0178206.g002

    Наблюдался значительный главный эффект времени (таблица 1), так что оценки, данные до обработки грунтовкой, были немного выше, чем оценки после обработок грунтовкой. .Также наблюдалась значительная взаимосвязь между количеством волос на лице и временем для оценок привлекательности (таблица 1), что отражает то, что оценки привлекательности женщин были значительно ниже для гладко выбритых лиц после лечения, чем до лечения ( t 687 = 3,31 , P <0,001), но не бородатые лица ( t 687 = 1,60, P = 0,110). Однако не было статистически значимых взаимодействий, связанных с лечением патогенов (таблица 1), ни для бородатости (рис. 3), ни для мужественности лица (рис. 4).Этот вывод сохранился при использовании разницы между оценками привлекательности после лечения и до лечения в качестве зависимой переменной (таблица S5).

    Рис. 3. Влияние лечения на предпочтения женщин в отношении бородатости мужчин.

    Данные представляют собой средние оценки привлекательности (± 1 SEM) гладко выбритых (пустые полосы) и полностью бородатых лиц (серые полосы) до и после контакта с эктопаразитами ( A. ), патогенами ( B. ), смешанный ( C. ) и контроль ( D.) лечения. N.S = статистически не значимо.

    https://doi.org/10.1371/journal.pone.0178206.g003

    Рис. 4. Влияние лечения на предпочтения женщин в отношении мужественности лица мужчин.

    Данные представляют собой средние оценки привлекательности (± 1 SEM) феминизированных (светлые столбцы) и маскулинизированных лиц (серые столбцы) для оценок до и после контакта с эктопаразитами ( A. ), патогенами ( B. ), смешанными ( C. ) и контроль ( D.) лечения. N.S = статистически не значимо.

    https://doi.org/10.1371/journal.pone.0178206.g004

    Мы провели дополнительный анализ, чтобы проверить, влияет ли статус участника на какие-либо взаимодействия лечения патогенов на предпочтения. Статистически значимых взаимодействий, связанных с текущим статусом взаимоотношений и лечением патогенов, бородатостью или маскулинностью лица, не было (таблица S6). Наблюдалась значительная взаимосвязь между маскулинностью лица и состоянием отношений с рейтингами привлекательности (таблица S6).Это отражает то, что, хотя оценки привлекательности женщин были значительно выше для высокой мужественности по сравнению с низкой мужественностью, этот эффект был больше среди женщин, которые в настоящее время состоят в отношениях ( t 538 = 11,19, P <0,001; d = 0,16), чем женщины, не состоящие в отношениях ( t 148 = 2,25, P = 0,026; d = 0,06). При сравнении участников, которые в настоящее время состоят в отношениях, и тех, у кого не было выявлено значимых различий в предпочтениях высокой мужественности лица ( t 686 = 1.24, P = 0,215) или низкая мужественность лица ( t 686 = 0,19, P = 0,852). Все другие взаимодействия, связанные со статусом отношений, не были статистически значимыми (таблица S6).

    Анализ 2: Связаны ли индивидуальные различия в отвращении с предпочтениями мужественности?

    Пустая модель без предикторов обнаружила, что внутриклассовая корреляция (т. Е. Доля общей дисперсии между людьми) указывает на то, что дисперсия в рейтингах привлекательности участников существует на обоих уровнях (ICC =.50), подтверждая использование моделирования смешанных эффектов. Компоненты дисперсии указаны в дополнительных материалах (таблица S7).

    Коэффициенты фиксированных эффектов приведены в таблице 2.

    Таблица 2. Коэффициенты фиксированных эффектов (и стандартные ошибки) и соответствующие 95% доверительные интервалы для влияния морального отвращения, сексуального отвращения, отвращения к патогенам, а также полового диморфизма и бородатости на оценки привлекательности.

    https: // doi.org / 10.1371 / journal.pone.0178206.t002

    В целом, бородатые лица были оценены как более привлекательные по сравнению с их чисто выбритыми собратьями. Патогенетическое отвращение значительно смягчило эти отношения, так что по мере того, как отвращение патогенов увеличивалось, также увеличивалось предпочтение бородатых лиц (рис. 5А). Однако мы также обнаружили, что сексуальное отвращение значительно отрицательно сказалось на предпочтениях бородатых лиц (рис. 5B). В целом маскулинизированные лица были оценены как более привлекательные, чем феминизированные версии.Только моральное отвращение смягчало эти отношения, так что предпочтение маскулинизированных лиц возрастало по мере возрастания морального отвращения (рис. 5C). Также имелось основное влияние отвращения к патогенам на рейтинги привлекательности, так что участники с более высоким отвращением к патогенам в целом давали более низкие оценки привлекательности.

    Рис. 5. Связь между тремя областями отвращения и женскими предпочтениями мужских черт мужского лица и бородатости.

    Данные показывают влияние патогенов с низким (-1SD) и высоким (+ 1SD) (A.), сексуальная (B) и моральная (C.) чувствительность к отвращению в зависимости от предпочтений женщин к маскулинности лица (слева) и маскулинности лица (справа). *** = 95% доверительный интервал не содержит 0, что указывает на статистическую значимость. N.S = статистически не значимо.

    https://doi.org/10.1371/journal.pone.0178206.g005

    Обсуждение

    Мы проверили, корректируют ли женщины свои предпочтения в отношении мужественности и бородатости лица после воздействия патогенных стимулов.Предыдущие исследования показали, что предпочтения женщин в отношении полового диморфизма на мужских лицах возрастают после воздействия визуальных сигналов высоких патогенов [28] и виньеток, описывающих высокие патогены [64]. Однако мы не обнаружили, что женщины предпочитают более мужественные лица сильнее после воздействия патогенных стимулов по сравнению со стимулами, не имеющими отношения к патогенам. Чтобы манипулировать патогенными сигналами, мы использовали стимулы, которые, как ранее было показано, вызывают сильную реакцию отвращения [57], и которые, как было установлено, активируют женские предпочтения в отношении полового диморфизма на мужских лицах [28].Наши результаты присоединяются к растущему числу публикаций, в которых ставится вопрос о том, влияет ли опасность заболевания на предпочтения женщин в отношении маскулинности лица [31,32].

    Мы также проверили, объясняет ли гипотеза избегания эктопаразитов, согласно которой предпочтения женщин в отношении волос на лице и теле мужчин должны уменьшаться после контакта с эктопаразитами [36], снижение предпочтений мужчин в отношении бородатости. Мы подготовили участников с помощью изображений, на которых изображены различные виды вшей и клещей, которые прячутся на коже и прикрепляются к волосам на теле, которые были признаны значительно более отвратительными по сравнению с контрольными изображениями.Однако мы не обнаружили, что предпочтения женщин к бороде уменьшились в результате воздействия эктопаразитов или любого другого патогенного состояния. Предыдущие исследования показали, что растительность на лице усиливает восприятие гневных выражений лица, но снижает эффект улыбки [65]. Будущие исследования с использованием большего количества динамических стимулов, чем строго контролируемые составные стимулы с нейтральным выражением лица, могут быть полезны для тестирования эффектов избегания растительности на лице после воздействия патогенных стимулов.Наши результаты настоящего исследования подтверждают предыдущие исследования, показывающие, что праймирование против эктопаразитов и патогенов не меняет предпочтений женщин в отношении волос на груди и туловище у мужчин [66], и предполагает, что гипотеза избегания эктопаразитов может не объяснять различия в предпочтениях женщин в отношении андроген-зависимых волос на лице или теле. волосы у мужчин.

    В дополнение к проверке того, оказывает ли праймирование на патогенные стимулы причинно-направленное воздействие на предпочтения женщин в отношении бороды и мужественности лица, мы также проверили, связаны ли индивидуальные различия в чувствительности отвращения к патогенам, о которых сообщают сами пациенты, с предпочтениями мужественности и бородатости.Мы не обнаружили связи между тем, что женщины предпочитают маскулинность лица, с отвращением к патогенам, о которых они сообщают сами. Это противоречит предыдущим исследованиям, в которых сообщалось о том, что предпочтения женщин в отношении маскулинности лица были положительно связаны с их отвращением к патогенам [26,27], но поддерживает растущее количество исследований, которые не смогли найти эту связь [29]. Потенциальная причина нашей неспособности найти какую-либо связь между предпочтениями маскулинности на лице и самооценкой отвращения к патогенам может быть частично связана с тем, что мы используем непрерывную шкалу оценок, которая оказалась менее действенной по сравнению с парадигмами принудительного выбора. [30].Мы действительно обнаружили слабую положительную связь между оценками морального отвращения и предпочтениями в отношении маскулинности лица, что может отражать консерватизм и предпочтения гендерной типичности лиц [67]; хотя предыдущие исследования не смогли обнаружить влияние чувствительности к моральному отвращению на предпочтения маскулинности лиц [27,29]. В сочетании с другими недавними открытиями [29,68], наши результаты ставят под вопрос, существует ли связь между опасениями патогенов и предпочтением маскулинности лица.

    Мы также обнаружили, что предпочтения женщин к бородатости мужчин положительно связаны с отвращением к патогенам, о которых они сообщают сами, но отрицательно — с отвращением к сексу.Следуя гипотезе избегания эктопаразитов [53], мы предсказали, что отвращение женщин к патогенам будет негативно связано с предпочтением волос на лице. Положительная связь, о которой мы сообщаем здесь, может быть интерпретирована как поддержка гипотезы о паразиторезистентности [69], так как волосы на лице потенциально могут служить источником болезни, переносящей эктопаразиты, которые могут иметь влияние на выживаемость самцов у предков [34–36], так что только высокие качественные мужчины могли ухаживать за бородой. Однако данные медицинских исследований о том, что в бороде есть бактерии, неоднозначны [50,70,71], и мы не обнаружили причинного влияния возбудителей болезней на предпочтения бороды.Отрицательная связь между предпочтением бороды и самооценкой сексуального отвращения может отражать предпочтения в отношении признаков мужского консерватизма, поскольку волосы на лице связаны с мужественностью и доминированием [72–76], политическим консерватизмом [77] и одобрением типичных гендерных ролей в гетеросексуальные отношения [78,79]. Однако привычки мужчин к внешнему виду заметно различаются между популяциями и внутри них [80,81], а связь между выбором иметь растительность на лице в разных культурах явно не связана с демографическими факторами, связанными с экономикой и гендерным неравенством [81].Таким образом, мы с осторожностью относимся к обнаруженным здесь тонким ассоциациям между самооценкой отвращения и предпочтениями к мужественности и бородатости лица и предполагаем, что требуется дальнейшее повторение из дополнительных исследуемых популяций.

    Пересечение между биологией и культурой в формировании предпочтений партнера имеет некоторый потенциал для открытия новых механизмов, лежащих в основе поддержания вариативности предпочтений в отношении привлекательных черт [82]. Различия внутри культур и между культурами в том, как женский выбор может формировать мужские привычки ухода за внешностью, только недавно начали привлекать внимание [81,83] и не повлияли на роль богатства патогенов в поддержании межкультурных различий в уходе за волосами на лице или предпочтениях женщин в отношении растительности на лице. [81].Кроме того, в то время как межкультурные исследования показали, что предпочтения женщин в отношении маскулинности лица были наиболее сильными в странах с более высоким бременем болезней и сокращенной продолжительностью жизни [22–24], в исследованиях участвовали люди не из так называемых СТРАННЫХ (западных, образованных, промышленно развитых стран). , Богатые и демократические) общества [84] не обнаружили этого эффекта [31,85]. Кроме того, исследования, касающиеся индивидуальных различий в фертильности женщин, также не обнаружили, что предпочтение бородатости или волос на теле тем больше, чем выше фертильность [48, 86–88].Наконец, среди однояйцевых и неидентичных близнецов 38% различий в предпочтениях женской маскулинности на лице было обусловлено генетической изменчивостью, в то время как самооценка социосексуальности, фертильности и отвращения к патогенам составляла менее 1% [32]. Взятые вместе, результаты текущих и других недавних исследований ставят под вопрос, объясняют ли аспекты поведенческой иммунной системы различия в предпочтениях женщин в отношении мужских черт лица.

    Вспомогательная информация

    S4 Таблица.Коэффициенты фиксированных эффектов (и стандартные ошибки) и связанные с ними доверительные интервалы

    95 % для влияния морального отвращения, сексуального отвращения, отвращения к патогенам, а также полового диморфизма и бородатости только на рейтинги привлекательности, включая испытания перед манипуляциями.

    https://doi.org/10.1371/journal.pone.0178206.s005

    (DOCX)

    S5 Таблица. ANOVA с повторными измерениями проверяет влияние бородатости (чисто выбритая, полная борода), мужественности (+ 50%, -50%) и лечения патогенов (эктопаразиты, патогены, смешанные и контрольные) на разницу между женщинами после лечения и оценки привлекательности мужских лиц до лечения.

    https://doi.org/10.1371/journal.pone.0178206.s006

    (DOCX)

    S6 Таблица. ANOVA с повторными измерениями с учетом бороды (чисто выбритая, полная борода), мужественности (+ 50%, -50%) и времени (до, после) в качестве факторов внутри субъектов и лечения патогенов (эктопаразиты, патогены, смешанные и контроль) и статус отношений (в отношениях, холост) как межсубъектные факторы.

    https://doi.org/10.1371/journal.pone.0178206.s007

    (DOCX)

    Вклад авторов

    1. Концептуализация: BJWD TLM AJL.
    2. Обработка данных: TLM AJL BJWD.
    3. Формальный анализ: BJWD AJL TLM.
    4. Получение финансирования: BJWD.
    5. Методология: TLM AJL BJWD.
    6. Администрация проекта: TLM MJS RES JMS.
    7. Ресурсы: BJWD AJL.
    8. Надзор: BJWD.
    9. Написание — первоначальный черновик: TJM BJWD AJL.
    10. Написание — просмотр и редактирование: BJWD TLM AJL MJS RES JMS.

    Список литературы

    1. 1. Кокко Х., Дженнионс, доктор медицины, Брукс Р. Объединение и тестирование моделей полового отбора. 2006; Ann Rev Ecol Evol Syst. 2006; 37: 43–66.
    2. 2. Дженнионс, доктор медицины, Петри М. Вариации в выборе партнера и предпочтениях при спаривании: обзор причин и последствий. Biol Rev.1997; 72: 283–327. pmid: 44
    3. 3. Эйбл Д. Гипотеза индикатора заражения для полового отбора, опосредованного паразитами. Proc Natl Acad Sci.1996; 93: 2229–2233. pmid: 8700912
    4. 4. Вергара П., Мужот Ф., Мартинес-Падилья Дж., Леки Ф., Редпат С.М. Условная зависимость вторичного полового признака сильнее при высоком уровне паразитарной инфекции. Behav Ecol. 2012; 23: 502–511.
    5. 5. Adamo SA, Spiteri RJ. Он здоров, но переживет ли он чуму? Возможные ограничения при выборе партнера из-за устойчивости к болезням. Anim Behav. 2009; 77: 67–78.
    6. 6. Вулф Н.Д., Дунаван С.П., Даймонд Дж.Истоки основных инфекционных заболеваний человека. Nature.2007; 447: 279–283. pmid: 17507975
    7. 7. Шаллер М. Поведенческая иммунная система и психология человеческой социальности. Фил Транс Р. Соц Б. 2011; 366: 3418–3426. pmid: 22042918
    8. 8. Торнхилл Р., Финчер С. Теория ценностей и социальности, вызванная паразитарным стрессом: Springer International Publishing; 2014.
    9. 9. Тайбур JM, Gangestad SW. Предпочтения партнера и инфекционное заболевание: теоретические соображения и доказательства у людей.Trans R Soc B. 2011; 366: 3375–3388.
    10. 10. Gangestad SW, Grebe NM. Избегание патогенов в рамках интегрированной иммунной системы: несколько компонентов с разными затратами и преимуществами. Evol Behav Sci. 2014; 8: 226–234.
    11. 11. Whitehouse AJ, Gilani SZ, Shafait F, Mian A, Tan DW, Maybery MT и др. Пренатальное воздействие тестостерона связано с сексуально диморфной морфологией лица во взрослом возрасте. Proc R Soc B. 2015; 282, 20151351. pmid: 26400740
    12. 12. Thornhill R, Gangestad SW.2006. Половой диморфизм лица, стабильность развития и восприимчивость к болезням у мужчин и женщин. Evol Hum Behav. 2006; 27: 131–144.
    13. 13. Родос Дж., Чан Дж., Зебровиц Л.А., Симмонс Л.В. Признает ли половой диморфизм на лицах здоровье? Proc R Soc B. 2003; 270 (Дополнение 1), S93 – S95.
    14. 14. Рантала MJ, Мур FR, Скринда I, Крама Т., Кивленице I, Кеко С. и др. Доказательства гипотезы связанной со стрессом иммунокомпетентности у людей. Nat Comm, 2012; 3, 694.
    15. 15. Muehlenbein MP, Bribiescas RG. Иммунные функции, опосредованные тестостероном, и история жизни мужчин. Am J Hum Biol. 2005; 17: 527–558. pmid: 16136532
    16. 16. Gettler LT. Применение социоэндокринологии к эволюционным моделям: отцовство и физиология. Evol Anthropol. 2014; 23: 146–160. pmid: 25116846
    17. 17. Родос Дж., Морли Дж., Симмонс Л. В.. Женщины могут судить о сексуальной неверности по незнакомым мужским лицам. Письма по биологии, 2013 г .; 9: 20120908.pmid: 23221873
    18. 18. Родс Дж., Симмонс Л. В., Питерс М. Привлекательность и сексуальное поведение: способствует ли привлекательность успеху спаривания? Evol Hum Behav. 2005; 26: 186–201.
    19. 19. Перретт Д.И., Ли К.Дж., Пентон-Воак И., Роуленд Д., Йошикава С., Берт Д.М. и др. Влияние полового диморфизма на привлекательность лица. Природа. 1998; 394: 884–887. pmid: 9732869
    20. 20. Крюгер DJ. Мужественность мужского лица влияет на характеристики личности и репродуктивную стратегию.Pers Relatsh. 2006; 13: 451–463.
    21. 21. Gangestad SW, Симпсон JA. Эволюция человеческого спаривания: компромиссы и стратегический плюрализм. Behavi Brain Sci. 2000; 23: 573–587.
    22. 22. Дебруин Л.М., Джонс Британская Колумбия, Кроуфорд-младший, Веллинг магистр права, Литтл А.С. Здоровье нации определяет их партнерские предпочтения: межкультурные различия в предпочтениях женщин в отношении маскулинизированных мужских лиц. Proc R Soc B. 2010a; 277: 2405–2410.
    23. 23. Дебруин Л.М., Джонс BC, Литтл А.С., Кроуфорд-младший, Веллинг, магистр права.Еще одно свидетельство региональных различий в предпочтениях женщин в отношении маскулинности. Proc R Soc B. 2011; 278: 813–814.
    24. 24. Дебруин Л.М., Литтл А.С., Джонс, Британская Колумбия. Распространение теории паразитарного стресса на вариации предпочтений человека в отношении спаривания. Behav Brain Sci. 2012, 35: 86–87. pmid: 22289354
    25. 25. Мур FR, Coetzee V, Contreras-Garduño J, Debruine LM, Kleisner K, Krams I, et al. Межкультурные различия в предпочтениях женщин в отношении сигналов половых гормонов и гормонов стресса на мужском лице.Biol Lett. 2013, 9: pmid: 23536442
    26. 26. ДеБрюн Л.М., Джонс Б.К., Тайбур Дж. М., Либерман Д., Грискявичюс В. Женские предпочтения мужественности в мужских лицах предсказываются отвращением патогенов, но не моральным или сексуальным отвращением. Evol Hum Behav. 2010b; 31: 69–74.
    27. 27. Джонс BC, Файнберг Д.Р., Уоткинс К.Д., Финчер К.Л., Литтл А.С., Дебруин Л.М. Патогенетическое отвращение предсказывает, что женщины предпочитают мужественность в голосах, лицах и телах мужчин. Behav Ecol. 2013; 24: 373–379.
    28. 28. Литтл А.С., Дебруин Л.М., Джонс BC. Воздействие визуальных сигналов о заражении патогенами меняет предпочтения к мужественности и симметрии лиц противоположного пола. Proc R Soc B. 2011; 278: 2032–2039. pmid: 21123269
    29. 29. Ли А.Дж., Дуббс С.Л., Келли А.Дж., фон Хиппель В., Брукс Р.С., Зитч Б.П. Атрибуты лица человека, но не воспринимаемый интеллект, используются в качестве индикаторов здоровья и потенциала обеспечения ресурсами. Behav Ecol. 2013; 24: 779–787.
    30. 30. Ли AJ, Zietsch BP.Отвращение к патогенам у женщин, предопределяющее предпочтение маскулинности лица, может зависеть от возраста и дизайна исследования. Evol Hum Behav. 2015; 36: 249–255.
    31. 31. Scott IML, Clark AP, Josephson SC, Boyette AH, Cuthill IC, Fried RL, et al. 2014. Человеческое предпочтение сексуально диморфных лиц может быть эволюционно новым. Proc Natl Acad Sci. 2014; 111: 14388–14393. pmid: 25246593
    32. 32. Зитч Б.П., Ли А.Дж., Шерлок Дж. М., Джерн П. Различия в предпочтениях женщин в отношении выявленных контекстно-зависимых эффектов.Psychol Sci. 2015; 26: 1440–1448. pmid: 26253549
    33. 33. Ракстон Г.Д., Уилкинсон Д.М. Избегание перегрева и селекция как на выпадение волос, так и на двуногость у гомининов. Proc Natl Acad Sci. 2011; 108: 20965–20969. pmid: 22160694
    34. 34. Пагель М., Бодмер В. У голой обезьяны было бы меньше паразитов. Proc R Soc B. 2003; 270 (Дополнение 1): S117 – S119.
    35. 35. Рантала MJ. Человеческая нагота: адаптация против эктопаразитов? Int J Parasitol. 1999; 29: 1987–1989.pmid: 10961855
    36. 36. Рантала MJ. Эволюция наготы у Homo sapiens. J Zool. 2007; 273: 1–7.
    37. 37. Диксон А.Ф., Диксон Б.Дж., Андерсон М.Дж. 2005. Половой отбор и эволюция визуально заметных половых диморфных черт у самцов обезьян, обезьян и людей. Ann Rev Sex Res. 2005; 16: 1–17.
    38. 38. Грютер С.К., Ислер К., Диксон Б.Дж. 2015. Являются ли статусные значки приматов адаптивными в больших группах? Evol Hum Behav. 2015; 36: 398–406.
    39. 39. Блейк К.Р., Йих Дж., Чжао К., Сун Б., Хармон-Джонс С. Патогены, передающиеся через кожу, и хиби-джиби: свидетельство подкласса стимулов отвращения, которые вызывают качественно уникальный эмоциональный ответ. Cogn Emot. 2016; 1–16. pmid: 27380127
    40. 40. Prokop P, Usak M, Fančovičová J. Здоровье и предотвращение макропаразитов: предварительное кросс-культурное исследование. J Ethol. 2010; 28: 345–351.
    41. 41. Лоренц А.Р., Либаркин Ю.С., Ординг Г.Дж.Отвращение к некоторым членистоногим совпадает с отвращением, вызванным патогенами. Global Ecol Conserv. 2014; 2: 248–254.
    42. 42. Prokop P, Fančovičová J, Fedor P. Паразиты улучшают поведение человека по уходу за собой и удерживают информацию. Поведенческий процесс. 2014; 107: 42–46.
    43. 43. Прокоп П. Мужское предпочтение женских лобковых волос: эволюционный взгляд. Anthropo Anz. 2016; 73: 169–175
    44. 44. Диксон А.Ф., Холливелл Г., Восточный Р., Вигнараджа П., Андерсон М.Дж.Мужской соматотип и полнота как детерминанты сексуальной привлекательности для женщин. Arch Sex Behav. 2003; 32: 29–39. pmid: 12597270
    45. 45. Диксон Б.Дж., Диксон А., Морган Б., Андерсон М. Телосложение человека и сексуальная привлекательность: Сексуальные предпочтения мужчин и женщин в Бакосиленде, Камерун. Arch Sex Behav. 2007a; 36: 369–375.
    46. 46. Диксон Б.Дж., Диксон А., Бишоп П., Пэриш А. Человеческое телосложение и сексуальная привлекательность мужчин и женщин: Новая Зеландия — США. Сравнительное исследование.Arch Sex Behav. 2010; 39: 798–806. pmid: 1

      85
    47. 47. Диксон Б.Дж., Диксон А.Ф., Ли Б., Андерсон М.Дж. Исследования человеческого телосложения и сексуальной привлекательности: сексуальные предпочтения мужчин и женщин в Китае. Am J Hum Biol. 2007b; 19: 88–95.
    48. 48. Рантала MJ, Pölkki M, Rantala LM. Предпочтение мужских волос на теле человека меняется в течение менструального цикла и менопаузы. Behav Ecol. 2010; 21: 419–423.
    49. 49. Valentova JV, Varella MAC, Bártová K, Štěrbová Z, Dixson BJW.2017. Предпочтения партнера и выбор волос на лице и теле у гетеросексуальных женщин и гомосексуальных мужчин: влияние пола, популяции, гомогамии и эффекта импринтинга. Evol. Гм. Behav. 38: 241–248.
    50. 50. McLure HA, Mannam M, Talboys CA, Azadian BS, Yentis SM. Влияние растительности на лице и секса на распространение бактерий под объектом в маске. Анестезия. 2000; 55: 173–176. pmid: 10651682
    51. 51. Ролл S, Verinis JS. Стереотипы волосистой части головы и лица на основе семантического дифференциала.Psychol Rep. 1971; 28: 975–980.
    52. 52. Диксон Б.Дж., Суликовски Д., Гауда-Фоссос А., Рантала М.Дж., Брукс Р.К. Парадокс маскулинности: мужественность лица и бородатость взаимодействуют, чтобы определить женскую оценку привлекательности лица мужчин. J Evol Biol. 2016; 29: 2311–2320. pmid: 27488414
    53. 53. Прокоп П., Рантала М. Дж., Усак М. и Сенай И. Под влиянием паразитов на то, что женщины предпочитают волосы на груди у мужчин? Arch Sex Behav. 2013; 42: 1181–1189. pmid: 22971802
    54. 54.Диксон Би Джей, Ли Эй Джей, Шерлок Дж. М., Таламас С. Н.. (2017). Под бородой: влияет ли морфометрия лица на силу суждений о мужской бороде? Evol Hum Behav. 2017; 38: 164–174.
    55. 55. ДеБруин Л.М., Тиддеман, Б.П. 2016. Webmorph. http://webmorph.org.
    56. 56. Бенсон П.Дж., Перретт Д.И. Извлечение прототипов изображений лиц из экземпляров. Восприятие, 1993; 22: 257–262. pmid: 8316513
    57. 57. Кертис В., Аунгер Р., Рэби Т.Доказательства того, что отвращение возникло для защиты от риска заболевания. Proc R Soc B. 2004; 271 (Приложение 4), S131 – S133.
    58. 58. Кинси А.С., Помрой В.Б., Мартин К.Э. Сексуальное поведение человека мужского пола. Филадельфия: Сондерс; 1948.
    59. 59. Тайбур Дж. М., Либерман Д., Грискявичюс В. Микробы, совокупление и мораль: индивидуальные различия в трех функциональных областях отвращения. J Personal Soc Psychol. 2009; 97: 103–122.
    60. 60. Джонс BC, DeBruine LM, Little AC, Conway CA, Welling LLM, Smith FG.Стремление к сенсациям и предпочтения мужчин в отношении лица. Evol Hum Behav. 2007; 28: 439–446
    61. 61. Веллинг магистр права, Джонс BC, ДеБруин Л.М. Сексуальное влечение положительно связано с предпочтениями женщин в отношении полового диморфизма в мужских и женских лицах. Pers Indiv Differ. 2008; 44: 161–170
    62. 62. Мейсон В., Сури С. Проведение поведенческих исследований механического турка Amazon. Методы Behav Res. 2011; 43: 1–23
    63. 63. Raudenbush SW, Bryk AS. Иерархические линейные модели: приложения и методы анализа данных (т.1). Мудрец; 2002.
    64. 64. Уоткинс К.Д., ДеБруин Л.М., Литтл А.С., Файнберг Д.Р., Джонс BC. Основное внимание уделяется угрозе патогенов по сравнению с нехваткой ресурсов: разобщающее влияние на восприятие женщинами привлекательности и доминирования мужчин. Behav Ecol Sociobiol. 2012; 66: 1549–1556.
    65. 65. Диксон Б.Дж., Васи П.Л. Борода усиливает восприятие мужской агрессивности, доминирования и возраста, но не привлекательности. Behav Ecol. 2012; 23: 481–490.
    66. 66. Прокоп П., Рантала М.Ю., Фанчовичова Ю.Приспособлена ли пластичность брачных предпочтений к предполагаемому воздействию патогенов? Acta Ethol. 2012; 15, 135–140.
    67. 67. Инбар Ю., Писарро Д., Айер Р., Хайдт Дж. Чувствительность к отвращению, политический консерватизм и голосование. Soc Psychol Personal Sci. 2012; 3: 537–544.
    68. 68. Scott IML, Clark AP, Boothroyd LG, Penton-Voak IS. Действительно ли мужские лица сигнализируют о наследственной иммунокомпетентности? Behav Ecol. 2013; 24: 579–589. pmid: 23555177
    69. 69. Гамильтон У.Д., Зук М.Унаследованная настоящая фитнес и яркие птицы: роль паразитов? Наука. 1982: 218: 384–387. pmid: 7123238
    70. 70. Линдехолм Ю.Н., Арпи М. Волосы на лице — как насчет техников клинической микробиологии? J Hosp Infect. 2016; 93: 313–314. pmid: 27160869
    71. 71. Парри Дж. А., Карау М. Дж., Ахо Дж. М., Тонтон М., Патель Р. С бородой или без бороды? Бактериальное выделение среди хирургов. Ортопедия, 2016; 39: e290 – e294. pmid: 26942473
    72. 72. Нив Н., Шилдс К.(2008). Влияние манипуляций с растительностью на лице на восприятие женщинами привлекательности, мужественности и доминирования в мужских лицах. Личность и индивидуальные различия, 45, 373–377.
    73. 73. Диксон Б.Дж., Брукс Р.С. Роль волос на лице в восприятии женщинами привлекательности, здоровья, мужественности и родительских способностей мужчин. Evol Hum Behav. 2013; 34, 236–241.
    74. 74. Шерлок Дж. М., Тегг Б., Суликовски Д., Диксон Б. Дж.. (2017). Мужественность и бородатость лица определяют явную, но не скрытую реакцию мужчин на мужское доминирование.Адаптировать Hum Behav Physiol. 2017; 3, 14–29.
    75. 75. Muscarella F, Cunningham MR. Эволюционное значение и социальное восприятие мужского облысения и растительности на лице. Ethol Sociobiol. 1996; 17: 99–117.
    76. 76. Addison WE. Борода как фактор воспринимаемой мужественности. Навыки восприятия моторики. 1989; 68: 921–922.
    77. 77. Herrick R, Mendez JM, Pryor B. Razor’s edge: политика волос на лице. Soc Sci Q.2015; 96: 1301–1313.
    78. 78.Олдмидоу Дж. А., Диксон Б. Дж.. Ассоциация между мужскими сексистскими взглядами и растительностью на лице. Arch Sex Behav. 2016a; 45: 891–899.
    79. 79. Олдмидоу Дж. А., Диксон Б. Дж.. Никаких противоречий, но направления дальнейших исследований: ответ Хеллмеру и Стенсону. Arch Sex Behav. 2016b; 45: 785–786.
    80. 80. Робинсон Д.Е. Мода на бритье и стрижку бороды: мужчины из Illustrated London News , 1842–1972. Am J Sociol. 1976; 81: 1133–1141.
    81. 81. Диксон BJW, Рантала MJ, Мело E, Брукс RC. Бороды и большой город: демонстрация мужественности может усиливаться в условиях скопления людей. Evol Hum Behav. 2017; 38: 259–264.
    82. 82. Диксон BJW. Мужественность и женственность. В Shackelford T. K. и Weekes Shackelford V. A. (Eds.), Энциклопедия эволюционной психологической науки. Springer. https://doi.org/10.1007/978-3-319-16999-6_3389–1; 2016
    83. 83. Джаниф З.Дж., Брукс Р.С., Диксон Б.Дж.Отрицательные частотно-зависимые предпочтения и вариации мужских волос на лице. Biol Lett. 2014; 10 (4), 20130958. pmid: 24740903
    84. 84. Генрих Дж., Гейне С. Дж., Норензаян А. Самые странные люди в мире? Behav Brain Sci. 2010; 33: 61–83. pmid: 20550733
    85. 85. Диксон BJW, Литтл AC, Диксон HGW, Брукс RC. Влияют ли преобладающие факторы окружающей среды на предпочтения человека в отношении морфологии лица? Поведенческая экология. 2017;
    86. 86. Диксон Б.Дж., Рантала М.Дж.Роль распределения волос на лице и теле в оценке женщинами сексуальной привлекательности мужчин. Arch Sex Behav. 2016; 45: 877–889. pmid: 262
    87. 87. Диксон BJW, Рантала MJ. Дополнительные доказательства с использованием непрерывного измерения вероятности зачатия того, что предпочтения женщин в отношении мужских волос на лице и теле могут не измениться в зависимости от оплодотворяемости. Arch Sex Behav. 2017; pmid: 28271348
    88. 88. Dixson BJ, Tam JC, Awasthy M. Меняются ли женские предпочтения мужчин в отношении растительности на лице в зависимости от репродуктивного статуса? Behav Ecol.2013; 24: 708–716.

    Анализ генетических и специфичных для пола источников неоднородности хозяина в выделении и распространении патогенов

    Abstract

    Неоднородность хозяев при передаче болезни широко распространена, но то, как именно различные характеристики хозяев влияют на эту неоднородность, остается плохо изученным. Отчасти сложность привязки индивидуальных вариаций к результатам в масштабе популяции состоит в том, что отдельные хозяева могут различаться по многим поведенческим, физиологическим и иммунологическим осям, что в совокупности будет влиять на их потенциал передачи.Более того, нам не хватает хорошо охарактеризованных эмпирических систем, которые позволяют количественно оценивать индивидуальные вариации ключевых черт хозяина, а также характеризовать генетические или основанные на полу источники таких вариаций. Здесь мы использовали Drosophila melanogaster и Drosophila C Virus в качестве модельной системы «хозяин-патоген», чтобы проанализировать генетические и специфичные для пола источники вариаций множественных признаков хозяина, которые являются центральными для передачи патогена. Наши результаты показывают сложные взаимодействия между генетическим фоном, полом и статусом спаривания самок, на которые приходится значительная доля различий в продолжительности жизни после инфекции, вирусной нагрузке, выделении вируса и вирусной нагрузке на момент смерти.Два примечательных открытия включают взаимосвязь между генетическим фоном и полом, на которую приходится почти 20% дисперсии вирусной нагрузки, и один только генетический фон, на который приходится ~ 10% дисперсии в выделении вируса и продолжительности жизни после инфекции. Чтобы понять, как вариации этих признаков могут создавать неоднородность в потенциале передачи отдельных патогенов, мы объединили показатели продолжительности жизни после заражения, выделения вируса и ранее опубликованные данные о социальной агрегации мух.Мы обнаружили, что взаимодействие между генетическим фоном и полом объясняет ~ 12% различий в индивидуальном потенциале передачи. Наши результаты подчеркивают важность характеристики источников вариабельности нескольких признаков хозяина для понимания движущих факторов неоднородности в передаче болезней.

    Информация об авторе

    Неоднородность хозяев в передаче патогенов представляет собой серьезное препятствие для прогнозирования и сведения к минимуму распространения инфекционных агентов. Отчасти сложность привязки индивидуальных вариаций к исходам эпидемии заключается в том, что отдельные хозяева могут различаться по нескольким поведенческим, физиологическим и иммунологическим осям, что может повлиять на их потенциал передачи.Более того, нам не хватает хорошо охарактеризованных эмпирических систем, позволяющих измерить несколько аспектов индивидуальных вариаций передачи патогенов. В этой работе мы используем сильные стороны плодовой мушки Drosophila как признанной и мощной модельной системы для генетики, поведения и иммунитета. Мы предоставляем данные на индивидуальном уровне по нескольким осям инфекции и тестируем, как каждый из этих компонентов испытывает вариации, обусловленные генетическим фоном хозяина, полом и статусом спаривания. Таким образом, мы можем идентифицировать источники неоднородности хозяев (т.е., генетический фон, пол) и специфические черты хозяина (социальная агрегация, выделение патогенов, продолжительность инфекции), которые являются наиболее важными для определения динамики заболевания. Мы обнаружили, что значительная часть межличностной неоднородности в передаче заболевания объясняется взаимодействием генотипа по полу, влияющим на вероятность того, что люди будут распространять вирус, но также и на то, насколько они вероятны.

    Образец цитирования: Siva-Jothy JA, Vale PF (2021) Анализ генетических и специфичных для пола источников гетерогенности хозяина в выделении и распространении патогенов.PLoS Pathog 17 (1): e1009196. https://doi.org/10.1371/journal.ppat.1009196

    Редактор: Уильям Б. Лудингтон, Научный институт Карнеги, США

    Поступила: 9 ноября 2019 г .; Одобрена: 30 ноября 2020 г .; Опубликовано: 19 января 2021 г.

    Авторские права: © 2021 Siva-Jothy, Vale. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в рукописи и ее файлах с вспомогательной информацией.

    Финансирование: J.A.S-J финансировался за счет стипендии NERC E3 DTP PhD, присужденной Эдинбургскому университету. P.F.V поддерживался стипендией Бранко Вайса (https://brancoweissfellowship.org/) и стипендией канцлера (Школа биологических наук Эдинбургского университета). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

    Введение

    Гетерогенность индивидуального хозяина в передаче патогенов является характерной чертой всех систем патоген-хозяин [1–5]. Такая неоднородность настолько распространена, что ее обобщили в «правило 20–80» из-за частого наблюдения, что 20% хозяев вносят примерно 80% передачи [1, 5, 6]. Более крайние формы неоднородности могут привести к более редким явлениям «сверхраспространения», способным вызвать крупные вспышки инфекционных заболеваний в популяциях людей и животных [2, 7].Мэри Мэллон, которая стала известна как «Тифозная Мэри», была суперпредставительницей особой дурной репутации, заразив более 50 человек Salmonella typhi , работая поваром в Нью-Йорке в начале 20-го -х годов века [8]. Помимо этого анекдотического примера, вспышки атипичной пневмонии в 2003 году в Сингапуре и Гонконге были значительно ускорены несколькими сверхраспространенными людьми, которые вызвали более 70% всех случаев передачи атипичной пневмонии [9]. Были зарегистрированы аналогичные уровни индивидуальной неоднородности передачи, которые, как считается, ускорили распространение MERS, Ebola и совсем недавно SARS-CoV2 [10, 11].

    Вспышки инфекционных заболеваний часто трудно предсказать, особенно когда влияние индивидуальной неоднородности трудно оценить с помощью традиционных мер риска вспышек. Широко используемым показателем скорости распространения патогенов является базовое репродуктивное число, R 0 , которое оценивает среднее количество ожидаемых вторичных инфекций, вызванных одним инфицированным человеком в полностью восприимчивой популяции. Хотя этот показатель чрезвычайно полезен в качестве широкомасштабного предиктора распространения (или исчезновения) эпидемии, фокусируясь на среднем населении, R 0 скрывает выбросы с потенциально более высокой склонностью к распространению патогенов [2, 3, 12].Более четкое понимание того, что движет неоднородностью в передаче патогенов, требует структуры, способной учитывать такие межличностные различия, что могло бы обеспечить более эффективные стратегии контроля, которые конкретно нацелены на людей с высоким риском и относятся к ним [2, 4]. Действительно, несколько эмпирических исследований патогенов человека и нечеловеческих организмов показали, что учет гетерогенности передачи при вмешательствах в заболевания может иметь непропорционально большое влияние на сокращение передачи патогенов [1, 13, 14].Таким образом, важность прогнозирования лиц из группы высокого риска до возникновения вспышек выдвинула понимание причин неоднородности передачи болезней на передний план эпидемиологических и экологических исследований [3, 12, 15, 16].

    Несмотря на распространенность, основные причины неоднородности передачи патогенов остаются неуловимыми. Индивидуальные вариации в сети контактов с хозяином могут быть важным фактором: именно то, что Брюшная Мэри работала поваром, познакомило ее со столькими восприимчивыми людьми.Однако то, что позволяло Тифозной Мэри оставаться в этой роли, было ее статусом бессимптомного носителя инфекции, что приводило к ее освобождению из карантина в нескольких случаях [8]. Точно так же отсутствие симптомов у ряда суперраспространителей SARS отсрочило их госпитализацию и позволило им продолжить распространение вируса [17]. Эти примеры подчеркивают, что достижение детального понимания источников неоднородности в передаче патогенов является сложной задачей, поскольку это является результатом сложных взаимодействий между множественными характеристиками хозяина, влияющими на социальные взаимодействия и динамику патоген-хозяин.Анализируя лежащие в основе генетические или экологические источники вариаций этих признаков, мы можем начать оценку того, как они влияют на три ключевых компонента передачи патогенов: i) скорость контактов между инфицированными и восприимчивыми людьми; ii) вероятность того, что контакт приведет к инфицированию; и iii) для патогенов с непрерывной передачей — продолжительность инфекции [12].

    На скорость контакта инфицированного и восприимчивого хозяина сильно влияет поведение хозяина, влияющее на передвижение и агрегацию, и может зависеть от плотности популяции [18], размера социальной группы [19] и поведенческих синдромов [20].Социальные сети часто демонстрируют крайнюю неоднородность в дикой природе [21, 22], и известно, что такие факторы, как генотип хозяина, пол, возраст и личность, влияют на социальную агрегацию у многих видов [23–26]. Когда люди заражаются инфекцией, их способность избавляться от патогенов и избавляться от них в основном определяется физиологическими и иммунными механизмами. Вариация этих механизмов в первую очередь влияет на вероятность передачи патогена и продолжительность инфекции [12, 27]. Описаны многие генетические и экологические источники вариаций физиологического иммунитета [28–30], включая коинфекцию [31, 32], питание [33, 34] и стресс [35, 36].Однако уместно отметить, что большая часть работ посвящена изолированному влиянию поведенческих, физиологических и иммунных особенностей на передачу. Хотя фенотипические вариации этих признаков не удивительны, то, как эти признаки изменяются совместно и как эта ковариация может управлять передачей патогенов, менее изучено [4, 37–39]. Следовательно, крайняя гетерогенность хозяина при передаче, вероятно, является результатом поведенческих черт, которые способствуют увеличению контактов, одновременно с физиологическими и иммунными чертами, которые увеличивают инфекционность [37-40].Крайне важно не только количественно оценить и измерить эффект неоднородности отдельных признаков, которые могут способствовать передаче, но и ключ к пониманию того, как несколько признаков могут совместно варьировать как «связанные неоднородности» [4, 39–43]. Поэтому для более глубокого понимания источников неоднородности передачи патогенов и того, как они могут совместно меняться, важно измерить причины и последствия вариабельности множества поведенческих, физиологических и иммунных характеристик.

    В настоящей работе мы стремились проверить, как общие источники вариаций между людьми — генетический фон, пол и статус спаривания — способствуют индивидуальной неоднородности в потенциале передачи патогенов.Плодовая муха, Drosophila melanogaster , является мощной и генетически управляемой моделью инфекции, иммунитета и поведения [44–46]. Несмотря на широкое использование D . melanogaster для решения вопросов иммунитета и поведения, он обычно не используется для объединения этих сильных сторон в качестве модели экспериментальной эпидемиологии (но см. [47, 48]). Здесь мы стремимся использовать сильные стороны D . Система melanogaster для изучения того, как изменение ключевых поведенческих и физиологических черт может повлиять на индивидуальный потенциал передачи болезни.

    Мы заразили самцов и самок из ряда естественного происхождения D . melanogaster генотипов с вирусом Drosophila C (DCV). DCV — это патоген, передающийся горизонтально, вызываемый мухами, который вызывает поведенческие, физиологические и метаболические патологии [26, 49–52]. Относительно мало известно об инфекции DCV у дикой дрозофилы, где она, по-видимому, встречается редко (что удивительно для модели вирусной инфекции плодовых мух) [53]; однако в лабораторных условиях Drosophila часто обнаруживается стойкая инфекция DCV на низком уровне [53, 54], что позволяет предположить, что горизонтальная передача, предполагаемая фекально-оральным путем, является обычным явлением.Каннибализм зараженных трупов мух также оказался жизнеспособным путем передачи [55], но неясно, является ли это обычным путем передачи в дикой природе.

    Мы измерили четыре характеристики хозяина и исходы инфекции, которые напрямую влияют на передачу патогенов. В первом эксперименте мы измерили (1) продолжительность жизни инфицированных и (2) вирусную нагрузку на момент смерти (VLAD) у одних и тех же мух. Продолжительность жизни инфицированного имеет значение в контексте передачи, потому что это время, в течение которого может происходить выделение патогенов.VLAD — полезная мера, потому что некоторая передача инфекции все еще возможна после смерти мухи [55]. Во втором эксперименте мы измерили (3) внутреннюю вирусную нагрузку и (4) сколько вируса было передано одной и той же мухой в первый, второй или третий день после заражения. Измерение количества вируса, растущего внутри мухи, и количества выделяемого вируса дает важное представление о том, как способность хозяина ограничивать распространение патогенов может влиять на инфекционность хозяина. Кроме того, измерение вирусной нагрузки и выделения в течение первых трех дней инфекции помогает охарактеризовать динамику патоген-хозяин на ранней стадии, в течение которой DCV активно растет [56].Наконец, мы интегрировали эти измерения, в дополнение к ранее описанным данным по изменчивости в социальной агрегации [26], в составную метрику индивидуального потенциала передачи, V [2, 12]. Изучение V позволило нам оценить, как генетические и половые различия могут приводить к межличностной гетерогенности при передаче патогенов.

    Методы

    Мухи и условия выращивания

    Мухи, использованные в экспериментах, были в возрасте 3–5 дней и происходили из десяти линий панели генетических ресурсов Drosophila (DGRP).Эти генетические фоны относятся к пяти из наиболее устойчивых (RAL-379, RAL-59, RAL-75, RAL-138, RAL-502) и восприимчивых (RAL-765, RAL-818, RAL-380, RAL-373, RAL). -738) на системную инфекцию вирусом Drosophila C [57], и были выбраны для обеспечения широкого диапазона чувствительности к вирусу. Девственные самки были изолированы от самцов в течение 7 часов после эклозии. Спарившиеся самки и самцы были произведены путем выращивания одной самки с одним самцом в течение 24 часов. Спаривание было подтверждено наблюдением за яйцеклеткой в ​​течение следующих 24 часов и последующим развитием этих яиц.Мух выращивали в пластиковых флаконах на стандартной диете из среды Льюиса при 18 ± 1 ° C с 12-часовым циклом свет: темнота. Приблизительно каждые 14 дней запасы переливали в новые флаконы. За месяц до экспериментов мух содержали при низкой плотности (~ 10 мух на флакон, чтобы гарантировать изобилие ресурсов) в течение двух поколений при 25 ± 1 ° C с 12-часовым циклом свет: темнота.

    Посев вируса и инфицирование

    Изолят вируса Drosophila C (DCV), использованный в этом эксперименте, был первоначально выделен в Шароле, Франция и выращен в Schneider Drosophila Line 2 (DL2), как описано ранее [52], в десятикратном разведении (10 8 ). инфекционных единиц на мл) в растворе ТРИС-HCl (pH = 7.3), аликвоты и замораживание при -70 ° C до тех пор, пока не потребуется. Для заражения DCV мух укололи в плевральный шов иглой диаметром 0,15 мм, согнутой под углом 90 ° ~ 0,5 мм от кончика, погруженной в DCV.

    Измерение продолжительности жизни и вирусной нагрузки на момент смерти

    Продолжительность жизни и вирусную нагрузку на момент смерти измеряли на одной и той же мухе. После заражения DCV мух изолировали и выращивали в стандартных флаконах. Затем за мухами наблюдали каждый день, пока все особи не умерли, когда их извлекали из флаконов, фиксировали в 50 мкл TRI-реагента и замораживали при -70 ° C.Для большинства групп лечения продолжительность жизни инфицированных и вирусная нагрузка на момент смерти были измерены для n = 17–20 особей (таблица S1).

    Установка для измерения вирусного роста и выделения

    Благодаря деструктивному отбору образцов мы измерили вирусную нагрузку и выделение одиночных мух в один момент времени — через 1, 2 или 3 дня после заражения (DPI). После заражения DCV одиночных мух помещали в пробирки Эппендорфа объемом 1,5 мл с ~ 50 мкл среды Льюиса на дне пробирки. Для измерения распространения вируса мух переносили в пробирки на 24 часа, сразу через 1-2 дня после системной инфекции.Еще через 24 часа мух удаляли и гомогенизировали в 50 мкл TRI-реагента, пробирки также промывали 50 мкл TRI-реагента путем встряхивания. Затем эти образцы замораживали при -70 ° C, чтобы дождаться количественного определения DCV с помощью qPCR. Для каждой комбинации пола и генетического фона в течение трех дней мы измерили вирусную нагрузку и выделение вируса у n = 7–15 мух на комбинацию половой линии и пола (таблица S2).

    Экстракция РНК DCV

    Для измерения вирусной нагрузки при смерти и выделении вируса РНК экстрагировали из образцов фенол-хлороформной экстракцией.Образцы размораживали на льду в течение 30 минут, а затем инкубировали при комнатной температуре в течение 5 минут. Затем образцы центрифугировали при 12000 × g в течение 10 минут при 4 ° C, после чего удаляли крупные частицы. Для разделения фаз образцы энергично встряхивали в течение 15 секунд, добавляли 10 мкл хлороформа и инкубировали при комнатной температуре еще 3 минуты перед центрифугированием при 12000 × g в течение 15 минут при 4 ° C. После разделения фаз верхний водный слой удаляли из каждого образца и добавляли к 25 мкл изопропанола, затем пробирки дважды переворачивали перед центрифугированием при 12000 × g в течение 10 минут при 4 ° C.Осажденную РНК затем промывали путем удаления супернатанта и повторного растворения осадка РНК в 50 мкл 75% этанола перед центрифугированием при 7500 × g в течение 5 минут при 4 ° C. Суспензию РНК получали путем удаления 40 мкл надосадочной жидкости этанола, позволяя остальным высохнуть путем выпаривания и растворения оставшегося осадка РНК в 20 мкл воды, свободной от РНКазы. Чтобы измерить вирусную нагрузку через 1, 2 или 3 дня заражения, мы экстрагировали РНК из мух, используя полуавтоматический процессор частиц MagMAX Express, используя протокол производителя набора для выделения общей РНК MagMAX-96 [58] с шагом элюирования, увеличенным до 18 минут. .Образцы РНК хранили при -70 ° C в ожидании обратной транскрипции.

    Протокол обратной транскрипции и КПЦР

    Экстрагированная РНК

    подвергалась обратной транскрипции с помощью обратной транскриптазы M-MLV и случайных гексамерных праймеров перед разбавлением 1: 1 водой, свободной от нуклеаз. Образцы кДНК хранили при -20 ° C до анализа КПЦР. Титр DCV определяли количественно с помощью кПЦР с использованием Fast SYBR Green Master Mix в системе Applied Biosystems StepOnePlus. Образцы подвергали циклу ПЦР при 95 ° C в течение 2 минут, затем 40 циклов: 95 ° C в течение 10 секунд, а затем 60 ° C в течение 30 секунд.Использованные прямые и обратные праймеры включали богатые 5’-AT лоскуты для улучшения флуоресценции (DCV_Forward: 5 ’AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3’; DCV Reverse: 5 ’AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3’). На всех планшетах были выполнены две технические повторы для каждого образца. Титр DCV рассчитывали путем абсолютного количественного определения с использованием стандартной кривой, построенной из 10-кратного серийного разведения (1-10 -12 ) кДНК DCV. Наш порог обнаружения был рассчитан для каждого планшета с использованием точки, в которой два образца на нашей стандартной кривой дали одинаковое значение Ct.Точка избыточности на стандартной кривой была принята за 0 вирусных частиц. Из-за того, что наш протокол обнаружения измеряет вирусные копии РНК, мы не можем комментировать жизнеспособность любого обнаруженного вируса. Мы преобразовали наши измерения вирусной РНК, чтобы получить количество копий вируса на муху.

    Расчет индивидуальных вариаций потенциала передачи,

    В

    Мы использовали показатели выделения вируса, продолжительности жизни после заражения и социальной агрегации для моделирования индивидуального потенциала передачи.Мы интегрировали эти меры, используя простую схему, которая описывает потенциал передачи как функцию частоты контактов между восприимчивыми и инфицированными людьми, вероятности того, что такой контакт приведет к инфекции, и продолжительности инфекционного периода [12]. Используя ранее проанализированные данные о социальной агрегации [26], мы использовали расстояние до ближайшего соседа в качестве меры скорости контакта. Предполагается, что мухи, которые собираются ближе к сородичам, имеют более высокую частоту контактов и, следовательно, с большей вероятностью распространяют DCV.Мы также предполагаем, что вероятность передачи увеличивается с выделением вируса. Поэтому мы принимаем количество вируса, выделяемого мухами, как приблизительную меру вероятности того, что контакт приведет к заражению. Используя эти характеристики, индивидуальный потенциал передачи V был рассчитан как:

    Расстояние агрегации, продолжительность жизни после заражения и распространение вируса измеряли в отдельных экспериментах. Поэтому, чтобы рассчитать V как меру индивидуального потенциала передачи, мы смоделировали теоретических людей, загрузив значения признаков, выбранные из каждого из этих трех наборов данных.Значения V были затем разделены на среднее значение для населения, V среднее значение , чтобы дать более четкую интерпретацию того, как индивидуальные потенциалы передачи связаны со средним значением для населения (что само по себе аналогично R 0 ). Например, человек со средним значением V / V из 3, имеет потенциал передачи, в три раза превышающий средний уровень передачи по населению. Мы смоделировали 60 особей для каждой комбинации пола и генетического фона, предполагая, что не было определенной ковариационной структуры между признаками, то есть были рассмотрены все возможные комбинации признаков.

    Статистический анализ

    Во всех экспериментах для анализа переменных непрерывного отклика использовались обобщенные линейные модели (GLM), а для анализа пропорций — логистические регрессии. Влияние пола или спаривания анализировалось в отдельных моделях, сравнивая самцов или девственных самок с одним и тем же набором данных спарившихся самок, соответственно.

    Для анализа продолжительности жизни были сконструированы две GLM, содержащие генетический фон трехстороннего взаимодействия, VLAD и пол или спаривание (таблица S3).Две GLM для VLAD содержали либо двустороннее взаимодействие между генетическим фоном и полом, либо двустороннее взаимодействие между генетическим фоном и спариванием (таблица S3).

    Из-за нулевой инфляции мы использовали две модели для последовательного анализа как вирусной нагрузки, так и данных о выделении вирусов. Вирусная нагрузка и выделение вируса подразделяются на качественные (доля ненулевых значений) и количественные вариации (различия между ненулевыми значениями). Сначала мы провели логистическую регрессию для всех значений в этих наборах данных и проанализировали долю значений, которые были больше нуля.Логистические регрессии, анализирующие половые различия в вирусной нагрузке, включали DPI (трехуровневый фактор: 1, 2 или 3 дня) и взаимодействие между генетическим фоном и полом (таблица S3). Для анализа влияния спаривания у самок на вирусную нагрузку логистические регрессии включали DPI и взаимодействие между генетическим фоном и спариванием (таблица S3). Для логистической регрессии выделения вируса использовалась аналогичная модель, которая также включала количественную вирусную нагрузку в качестве предиктора (таблица S3). После этих логистических регрессий нули были удалены из всех наборов данных для анализа подмножества положительных значений.GLM, используемые для анализа этих подмножеств, включали те же предикторы, что и соответствующие им логистические регрессии, для вирусной нагрузки: взаимодействие между генетическим фоном и полом или спариванием, наряду с DPI, с включением количественной вирусной нагрузки для выделения вируса (таблица S3).

    Из-за нулевой инфляции V также был проанализирован с помощью логистической регрессии с последующей GLM. Логистическая регрессия использовалась для анализа доли значений V , которые были больше нуля с двусторонним взаимодействием между полом и генетическим фоном в качестве предикторов (таблица S3).Затем нулевые значения V были удалены из набора данных, и GLM была использована для анализа различий в размере V , с взаимодействием между полом и генетическим фоном, включенным в качестве предиктора (таблица S3).

    Мы рассчитали величину отклонения и дисперсии, объясняемых предикторами в логистической регрессии и GLM, соответственно, путем деления общего отклонения или дисперсии, объясненных моделью. Там, где это уместно, мы сделали поправку на множественное тестирование с помощью поправки Бонферрони.Все статистические анализы и графики производятся в R 3.3.0 с использованием пакетов ggplot2 [59], lme4 [60] и multcomp [61].

    Результаты

    Продолжительность жизни после заражения

    Чтобы начать нашу характеристику неоднородности хозяев в распространении патогенов, мы измерили продолжительность жизни мух после септического заражения DCV. Это позволило нам не только подтвердить, что выбранные нами линии демонстрируют диапазон непрерывных вариаций восприимчивости [57], но и продолжительность жизни инфицированных также имеет прямое отношение к индивидуальному потенциалу передачи V [12], определяя полную протяженность инфекционного периода. (см. Расчет индивидуального изменения потенциала передачи , В, выше).Продолжительность жизни инфицированных значительно различалась между мужчинами и женщинами, и степень этой вариации, как и ожидалось, различалась в зависимости от генетического фона хозяина (рис. 1А и таблица 1). При любом генетическом происхождении средняя продолжительность жизни самцов составляла 14,1 дня, при этом RAL-75 (16 дней) выжил дольше всех, а RAL-765 (11,1 дня) — в течение самого короткого времени. Самки показали немного более низкую среднюю продолжительность жизни — 13,06 дня, при этом RAL-59 (15,1 дня) и RAL-765 (11,4 дня) выживали в течение самого длительного и самого короткого времени соответственно.При сравнении спарившихся самцов и самок или девственных и спарившихся самок генетический фон объяснил наибольшую дисперсию любого предиктора (7% и 10,9% соответственно; Таблица 1). Мы не нашли доказательств того, что спаривание влияет на продолжительность жизни самок после заражения DCV (рис. 1A и таблица 1).

    Рис. 1.

    Среднее ± SE (а) продолжительность жизни в днях после заражения и (б) вирусная нагрузка на момент смерти у самцов (красный), спарившихся самок (синий) и девственных самок (бледно-голубой) из десяти генетических фонов. Ось x показывает номер строки из панели DGRP в возрастающем порядке в соответствии с самцами мух.(c) взаимосвязь между продолжительностью жизни после заражения и вирусной нагрузкой мух на момент смерти. Каждая точка — это отдельный самец (красный), спариваемая самка (синий) или девственная самка (бледно-голубой). Природа этих отношений в пределах каждого генетического фона представлена ​​линией наилучшего соответствия с помеченными выбросами.

    https://doi.org/10.1371/journal.ppat.1009196.g001

    Таблица 1. Выходные данные модели для тестов обобщенного линейного моделирования, выполненных на продолжительности жизни после заражения DCV.

    Аббревиатура VLAD используется вместо «вирусной нагрузки на момент смерти». Отдельные анализы были использованы для проверки влияния пола (верхняя модель) и спаривания у самок (нижняя модель).

    https://doi.org/10.1371/journal.ppat.1009196.t001

    Мы также решили измерить вирусную нагрузку на момент смерти (VLAD) у всех мух в день их смерти. Хотя мы ожидали, что постоянное изгнание вируса через дефекацию будет основным путем выделения патогенов, также возможно, что некоторая передача происходит после смерти мухи, например, через трофические пути передачи [55].VLAD не различалась между генетическим происхождением, полом или статусом спаривания самок (рис. 1B и таблица 2), а у мух, умерших раньше после заражения, VLAD был выше, чем у тех, которые умерли позже (рис. 1C и таблица 1).

    Таблица 2. Выходные данные модели для тестов обобщенного линейного моделирования, проведенных на вирусной нагрузке при гибели мух, инфицированных DCV.

    Для проверки влияния пола (верхняя модель) и спаривания у самок (нижняя модель) использовались отдельные анализы.

    https: // doi.org / 10.1371 / journal.ppat.1009196.t002

    Вирусная нагрузка

    Затем, в отдельном эксперименте, мы количественно оценили влияние генетики, пола и спаривания хозяина на заразность хозяина, что, как мы считали, включает как способность контролировать рост вируса, так и степень распространения вируса. После 24 часов септического заражения DCV мы наблюдали, что у значительного числа мух не было обнаруживаемых титров DCV, измеренных с помощью кПЦР (рис. 2A и S1). Мухи без обнаруживаемых нагрузок DCV могут отражать людей, способных ограничить начальный рост вируса, или могут быть вызваны вирусными титрами ниже порога обнаружения нашего qPCR и, следовательно, отражать людей с чрезвычайно низкими нагрузками DCV.В более естественных условиях эти нулевые значения отражали бы то, что наблюдается у недавно инфицированных людей или лиц, успешно ограничивающих рост патогена. Важно отметить, что в контексте борьбы с передачей заболевания люди с низкими вирусными титрами, вероятно, останутся незамеченными и могут подвергнуться риску передачи позже, если их вирусная нагрузка возрастет. Сначала мы проанализировали эту «качественную» нагрузку DCV, отражающую полное присутствие или отсутствие определяемых титров DCV (рис. 2A и таблица 3).Доля мух с определяемыми титрами DCV значительно варьировалась со временем (рис. 2А и таблица 3), а предикторами, объясняющими наибольшее отклонение, были взаимодействия между генотипами и полами (при сравнении спарившихся самцов и самок) и взаимодействия генотипов при спаривании. (при сравнении спарившихся или девственных самок), хотя каждый из этих эффектов составлял лишь примерно 5% отклонения (Таблица 3).

    Рис. 2.

    Среднее ± SE (a) доля мух с обнаруживаемой нагрузкой DCV и (b) вирусный титр мух с ненулевой нагрузкой DCV в течение первых 3 дней заражения.На обеих панелях числа на каждой панели обозначают генетический фон из DGRP, а цвет полос, точек и линий представляет пол и статус спаривания. Самцы показаны красным цветом, спарившиеся самки — синим, а девственные самки — бледно-голубым.

    https://doi.org/10.1371/journal.ppat.1009196.g002

    Таблица 3. Выходные данные модели для биномиальной логистической регрессии, проведенной для качественных нагрузок DCV (доля ненулевых нагрузок DCV).

    Аббревиатура DPI используется вместо «дней после заражения».Отдельные анализы были использованы для проверки влияния пола (верхняя модель) и спаривания у самок (нижняя модель).

    https://doi.org/10.1371/journal.ppat.1009196.t003

    Затем мы сосредоточили внимание на количественных вариациях в подгруппе мух с детектируемыми титрами DCV в качестве показателя вариации хозяина в способности ограничивать вирусный рост. Мы наблюдали значительные изменения в количественном изменении нагрузки DCV в течение первых трех дней заражения. Вирусная нагрузка достигла пика через 2 дня после заражения (попарное сравнение, p = 0.0012), прежде чем снизиться до уровня, аналогичного уровню через 1 день после заражения, через 3 дня после заражения (попарное сравнение, p = 0,068). Существенная часть дисперсии вирусных нагрузок может быть отнесена на счет взаимодействия генотипов по полу (19,2% при сравнении спарившихся самцов и самок) (рис. 2В и таблица 4).

    Таблица 4. Выходные данные модели для анализа GLM, проведенного для количественной нагрузки DCV (титры ненулевых нагрузок DCV).

    Аббревиатура DPI используется вместо «дней после заражения».Отдельные анализы были использованы для проверки влияния пола (верхняя модель) и спаривания у самок (нижняя модель).

    https://doi.org/10.1371/journal.ppat.1009196.t004

    Распространение вируса

    Во время деструктивного отбора проб у мух для количественной оценки внутренних вирусных титров мы также смогли получить для каждой мухи парные измерения количества вируса, выделившегося через один, два или три дня. Выделение вируса измеряли, помещая одиночных мух в пробирку Эппендорфа на 24 часа, удаляя мух из пробирки, промывая пробирку TRIzol и определяя количество присутствующей РНК DCV с помощью кПЦР.Как и при измерении вирусной нагрузки, мы не обнаружили DCV в выделении ряда мух (рис. 3A и S1). Опять же, мы интерпретируем эти нулевые значения как отражающие людей, которые выделяют очень низкие титры DCV или вообще не выделяют вируса. Качественное выделение (наличие или отсутствие выявляемого выделения вируса) значительно варьировалось в течение трех дней после заражения и зависело от генетического фона и его взаимодействия с полом (рис. 3А и табл. 5). Однако, хотя эти эффекты были значительными, они объясняли только 2-3% отклонения в доле мух с обнаруживаемым выделением вируса.Мы не обнаружили значительного влияния спаривания на наличие или отсутствие или выделение DCV (рис. 3A и таблица 5).

    Рис. 3.

    Среднее значение ± стандартная ошибка (a) доля мух, выделяющих ненулевые титры DCV, и (b) титр ненулевой подгруппы выделения вируса в течение первых 3 дней заражения. Панели обозначают генетический фон, а цвет полосок, точек и линий обозначает пол и статус спаривания. Самцы показаны красным цветом, спарившиеся самки — синим, а девственные самки — бледно-голубым. Полоски одного цвета на каждой панели на панели (а) представляют (слева направо) дни 1, 2 и 3 заражения.

    https://doi.org/10.1371/journal.ppat.1009196.g003

    Таблица 5. Выходные данные модели для анализа GLM, проведенного для качественного сброса DCV (доля выпадений с ненулевыми показаниями DCV).

    Аббревиатура DPI используется вместо «дней после заражения». Отдельные анализы были использованы для проверки влияния пола (верхняя модель) и спаривания у самок (нижняя модель).

    https://doi.org/10.1371/journal.ppat.1009196.t005

    У мух, у которых было обнаружено выделение DCV, мы сравнили количество вируса, выделившегося во флаконах за 3 дня.Подобно вирусной нагрузке, измеренной у мух, выделение вируса также достигло пика на 2-й день у большинства генетических фонов мух (рис. 3B, таблицы 5 и 6, попарные сравнения, p <0,0001). Количественные вариации в выделении DCV объяснялись генетическим фоном, а степень этой вариации определялась статусом спаривания самок, но не полом (рис. 3B и таблица 6). Величина дисперсии, объясняемой полом, составляла <1% по сравнению с генетическим фоном (9,48% и 5,82%) и его взаимодействием с полом (8.87%) или вязки (6,53%) (Таблица 6). Во всех группах лечения мы не обнаружили значимой взаимосвязи между вирусной нагрузкой и выделением (S1 рис. И таблица 6).

    Таблица 6. Выходные данные модели для анализа GLM, проведенного для количественного сброса DCV (подмножество сброса с ненулевыми показаниями DCV).

    Аббревиатура DPI используется вместо «дней после заражения». Отдельные анализы были использованы для проверки влияния пола (верхняя модель) и спаривания у самок (нижняя модель).

    https: // doi.org / 10.1371 / journal.ppat.1009196.t006

    Изменение потенциала передачи,

    В

    Чтобы произвести оценку индивидуального потенциала передачи, V [2, 12], мы объединили отдельные измерения продолжительности жизни и распространения вируса (1, 2 или 3 DPI), описанные выше, с ранее опубликованными данными о социальной агрегации у мужчин и самки одного генетического фона [26]. Путем моделирования теоретических «индивидуумов», где значение каждого признака было взято из этих экспериментально полученных распределений продолжительности жизни, линьки и асоциальной агрегации, мы получили распределение вариации индивидуального потенциала передачи V (рис. 4A).Это распределение потенциала передачи, В, , было нулевым (рис. 4A), вероятно, в результате того, что многие мухи не теряли DCV (рис. 3A). Таким образом, нулевые значения V представляют людей без риска передачи (рис. 4A), поскольку мухи, которые не выделяют вирус, по определению не имеют потенциала передачи, независимо от их агрегации и продолжительности жизни. Распределение V также было сверхдисперсным, с крайним правым хвостом, состоящим из людей с высоким потенциалом передачи патогенов относительно среднего популяции (рис. 4A).Учитывая нулевую инфляцию V, мы сначала проанализировали «качественную» вариацию в V (доля мух, у которых V > 0, то есть где вероятность вспышки равна нулю или положительна). Путем анализа источника вариации, отражающего вероятность вспышки). Мы обнаружили значительные различия между мужчинами и женщинами в представлении V> 0, причем степень этой разницы также определялась генетическим фоном (рис. 4В и таблица 7). Пол (0,28%), генетический фон (2.3%), а взаимодействие между ними (2,83%) объясняет относительно небольшое отклонение в вероятности вспышки (рис. 5 и таблица 7).

    Рис. 4.

    Результаты начального моделирования потенциала передачи ( V ) (n = 60): (a) распределение V относительно среднего значения для популяции ( V среднее ) у женщин ( синий) и самцов (красный), перекрытие между этими распределениями показано фиолетовым цветом. Все индивидуальные потенциалы передачи относятся к среднему по популяции ( V / V среднее значение = 1).Среднее значение ± стандартное отклонение от (b) доли мух с ненулевым потенциалом передачи и (c) потенциала передачи мух с ненулевым потенциалом передачи. На рис. на панелях (b) и (c) пол обозначен цветом, самцы — красным, а женские — синим. Ось абсцисс на панелях (b) и (c) отсортирована по возрастанию мужского генетического фона.

    https://doi.org/10.1371/journal.ppat.1009196.g004

    Рис. 5. Резюме процентной вариации или отклонения, объясняемой подмножеством предикторов при анализе потенциала передачи заболевания и исходов инфекции.

    Отдельные анализы были использованы для проверки эффекта спаривания у самок (три верхних ряда) и пола (три нижних ряда). Мы не анализировали влияние спаривания на V , так как это не было проверено в ранее опубликованном эксперименте социальной агрегации [26], использованном для расчета V .

    https://doi.org/10.1371/journal.ppat.1009196.g005

    Затем мы сосредоточились на подмножестве мух с положительным потенциалом передачи V , чтобы проверить, какие факторы будут влиять на «количественный» V, т. е. Насколько велики эти вспышки среди лиц, у которых действительно развиваются эпидемии (V> 0), и какие факторы объясняют различия в размере вспышки? Мы обнаружили значительные эффекты генетического фона и его взаимодействия с полом, которые вместе объясняли более 15% дисперсии V (рис. 5 и таблица 8).

    Обсуждение

    Мы количественно оценили генетические и половые вариации трех ключевых детерминант передачи DCV: продолжительность жизни после инфекции, выделение вируса и вирусная нагрузка. В сочетании с данными социальной агрегации это изменение привело к значительному влиянию генетики и пола хозяина на индивидуальный потенциал передачи, V . Хотя все три признака влияют на потенциал передачи, выделение вируса имеет фундаментальное значение, и, поскольку у многих людей выделение вируса не было обнаружено, этот признак, вероятно, будет иметь больший вклад в индивидуальный потенциал передачи V , чем изменение продолжительности жизни после заражения или заражения. социальная агрегация.Ниже мы обсуждаем центральную роль распространения вируса в передаче патогенов, связывая его с генетическими и половозависимыми эффектами, которые мы обнаружили в V , с широко наблюдаемой гетерогенностью в распространении патогенов.

    Влияние генетического фона хозяина на создание гетерогенности при передаче

    Генетический фон мух влияет как на то, будут ли мухи выделять DCV в данный день (что мы назвали качественным выпадением), так и на то, сколько они будут терять (количественное выпадение).Различия между генетическим фоном в качественном выделении были ключевой детерминантой изменчивости в V : в отсутствие выделения вируса риск передачи патогена отсутствует. Среди людей, которые теряют DCV, межличностная неоднородность в V достигалась разными путями. Некоторые генетические фоны, такие как мужчины из RAL-818, показали высокую долю людей, которые могут распространять DCV (рис. 4B), но демонстрируют относительно низкий потенциал передачи во время вспышки (рис. 4C).Напротив, другие группы, такие как женщины с генетическим происхождением RAL-380, показали одну из самых низких долей людей, способных достичь передачи (рис. 4B), но люди, которые действительно достигли передачи, преобладали в длинном хвосте распределения населения с значения V , которые были в несколько раз выше, чем в среднем по населению (рис. 4C).

    Генетический фон хозяина изменял выделение DCV различными способами. На представление обнаруживаемых уровней выделения вируса влиял генетический фон как часть взаимодействия с полом хозяина, в то время как это взаимодействие не оказывает значительного влияния на количественные вариации выделения DCV (таблицы 5 и 6).Сходные различия наблюдаются в степени отклонения и дисперсии, объясняемой генетическим фоном, в моделях качественной и количественной изменчивости в выделении DCV. Генетический фон составляет лишь 2,27% отклонения в качественном выделении DCV, тогда как на него приходится 9,48% отклонения в количественном выделении DCV (рис. 5). Таким образом, генетическая изменчивость, по-видимому, играет важную роль в определении линьки и по-разному влияет на качественную и количественную линьку. Аналогичное влияние генетического фона на выделение паразитов было зарегистрировано у улиток Ramshorn, Biomphlamaria glabrata , во время заражения Schistosoma mansoni , где генетический фон различается по тому, сколько яиц паразитов они сбрасывают и как быстро они начинают сбрасывать после заражения [ 62].

    Возможно, как прямое следствие этих генетических эффектов хозяина на распространение вируса, генетический фон хозяина также, по-видимому, играет ключевую роль в потенциале передачи V . Процент отклонения и дисперсии, объясняемых генетическим фоном, не сильно различается (2,3% и 4,13% соответственно). Однако взаимодействие генетического фона с полом составляло 11,4% дисперсии количественной вариации в выделении DCV, тогда как это же взаимодействие составляло только 2.83% отклонения в качественной вариации линьки (рис. 5). Проще говоря, межполовые взаимодействия играют относительно небольшую роль в том, происходит ли выделение вируса, но объясняют большую долю дисперсии в том, сколько вирусов выделяется.

    Генетическая изменчивость в выделении патогенов наблюдалась у ряда видов и, как было показано, оказывает важное влияние на динамику передачи [43–45]. Было показано, что семейства камбалов ( Scophthalmus maximus ) вызывают вспышки, которые различаются по скорости появления у людей симптомов инфекции и уровню смертности.Несмотря на то, что не измеряется напрямую, в основе этой вариации лежит выпадение, поскольку у S нет значительных различий. maximus продолжительность заражения и частота контактов [63]. Также было показано, что на распространение спор, в частности на количество спор, высвобождаемых в первые дни после заражения, влияет генотип растения-хозяина, Plantago lanceolata , при заражении несколькими штаммами грибкового патогена, Podosphaera plantaginis , и это экспериментальные данные хорошо коррелируют с различиями в динамике передачи на популяционном уровне дикого P . lanceolata популяций [43, 64].

    Влияние пола хозяина на неоднородность передачи

    Половые различия в передаче или выделении вируса, продолжительности жизни и социальной агрегации обычно наблюдаются у многих видов [65–68]. Наши данные дополняют эти доказательства половых различий с четкими качественными и количественными различиями в V между мужчинами и женщинами. Другая работа также показала ряд половых различий в выделении патогенов и паразитов [68–70].Хотя степень различий между самцами и самками также определялась генетическим фоном хозяина, в целом самцы имели более высокий потенциал передачи V по сравнению с самками. Отчасти этот половой эффект, вероятно, вызван более высоким выделением вируса у самцов мух: самцы с разным генетическим происхождением (RAL-379, RAL-738 и RAL-818) выделяют больше DCV, чем самки (рис. 3A). Интересно, что мы наблюдали значительные гендерные различия в вероятности обнаружения выделения вируса, но не в количестве выделяемого вируса.Это говорит о том, что мужчины и женщины могут различаться по своей способности избавляться от инфекции DCV в целом, но не по способности контролировать титры, если они не могут избавиться от инфекции. Однако важно отметить, что, хотя эффект был значительным, на пол мухи приходился очень небольшой процент отклонений в линьке (рис. 5).

    Многие примеры половых различий в поведенческих и физиологических чертах, влияющих на передачу болезней, наблюдались в целом ряде систем «хозяин-патоген» [65].Большая часть этой работы была проведена на млекопитающих-хозяевах, где выработка тестостерона, как было показано, способствует передаче за счет увеличения частоты контактов с самцами [71–74]. Влияние тестостерона на гетерогенность передачи, вероятно, распространяется и дальше, поскольку его иммуносупрессивные эффекты [75] также могут влиять на вариабельность инфекционности и продолжительности инфекции. В системах, не относящихся к млекопитающим, паттерны полоспецифичных вариаций передачи менее ясны [69]. Предрасположенная к самкам передача наблюдается у водяных блох, Daphnia magna , поскольку самки после смерти выделяют значительно больше спор паразитов, чем самцы [70].Женский D . Также было показано, что melanogaster задерживает совокупление с инфицированными людьми на более длительный срок, чем самцы, что связано с их повышенной восприимчивостью [76].

    Брачный статус самки в линьке

    Спарившиеся и девственные самки не показали каких-либо существенных различий почти во всех наших измерениях продолжительности жизни мух, вирусной нагрузки, выделения вируса и потенциала передачи. V . Двумя исключениями были значительный эффект спаривания генотипа в вероятности наличия определяемых титров DCV и в количестве DCV, выделяемого этими мухами, что позволяет предположить, что эффекты спаривания могут присутствовать только в некоторых генетических фонах.Это взаимодействие между спариванием и генетическим фоном объясняет ~ 5% дисперсии обнаруживаемой нагрузки DCV и ~ 9% дисперсии количества выпадения DCV (Рис. 5). Помимо генетического фона хозяина, спаривание может оказывать умеренное влияние на передачу, существуют различия между генетическим фоном в физиологических изменениях в кишечнике после спаривания, которые могут увеличить частоту дефекации [77], что, вероятно, приведет к увеличению вирусного выделения. Однако это физиологическое изменение не объясняет, почему девственные самки с определенным генетическим происхождением теряют больше, чем спарившиеся самки (рис. 3В).Относительно небольшое количество исследований рассматривало, как совокупление влияет на аспекты передачи болезней за пределами частоты контактов [78, 79].

    Путь заражения и обнаружение низкоуровневого распространения вируса

    Важное предостережение при интерпретации наших результатов связано с септическим путем заражения, которое мы использовали. Инфекция DCV редко встречается у диких мух [53], и ее естественный путь передачи не совсем ясен. Очень вероятно, что он передается фекально-орально, потому что он демонстрирует тканевый тропизм в отношении эпителия зоба и средней кишки и часто обнаруживается в качестве лабораторного контаминанта для многих линий скота [50, 54].Однако экспериментальная оральная инфекция имеет ограничение, требующее чрезвычайно высоких концентраций, чтобы вызвать летальную инфекцию [56, 80]. Это также приведет к неконтролируемым колебаниям, возникающим из-за различий между линиями мух и полами в их норме кормления. Однако даже во время септической инфекции DCV демонстрирует тканевый тропизм для урожая и кишечника, и, учитывая, что мы обнаружили DCV в выделении фекалий, это указывает на жизнеспособность измерения выделения вируса после системной инфекции. Однако путь заражения может до некоторой степени объяснить, почему мы обнаружили такую ​​слабую корреляцию между внутренней нагрузкой DCV и выделением DCV (S1, рис.).Во-первых, мы обязательно сравнивали вирусную нагрузку у всей мухи только с той фракцией вируса, которая установилась в кишечнике и затем попала во флакон. Связанное с этим следствие состоит в том, что, вероятно, будет задержка по времени между ростом гемоцели, миграцией в кишечник и, наконец, распространением вируса извне. Этот временной интервал между ростом и выделением может также объяснить, почему мы не наблюдали выделения у некоторых людей с повышенными внутренними вирусными титрами (супер-губки), в то время как у других наблюдалась неопределяемая внутренняя нагрузка, но очень высокие количества выделяемого вируса (супер-шеддеры) (S1 Рис).

    Заключительные замечания

    Объединив показатели распространения вируса, продолжительности жизни и социальной агрегации в простую схему индивидуального потенциала передачи, наша работа демонстрирует, что генетические и половые различия могут влиять на индивидуальную неоднородность в различных компонентах передачи болезни. Наши результаты также согласуются с наблюдением, что у большинства инфицированных людей очень мало вторичных случаев инфекции, если таковые вообще возникают. Неинфекционные люди особенно важны для прогнозирования вспышек инфекционных заболеваний, поскольку они скрывают лиц из группы высокого риска при традиционных оценках риска вспышек в масштабах всего населения.Наконец, мы надеемся, что эта работа также подчеркнет сильные стороны использования модельных систем для систематического анализа различных источников вариабельности передачи патогенов, что может служить инструментом как для проверки гипотез, так и для генерации гипотез в экологии болезней.

    Дополнительная информация

    S1 Рис. Взаимосвязь между вирусной нагрузкой мух и количеством вируса, который они выделяют в окружающую среду.

    Два различных фенотипа, в которых особи показывают нулевое значение для линьки или нагрузки и положительное значение для другого признака, отмечены красным (супергубки) или синим (супершеддеры).

    https://doi.org/10.1371/journal.ppat.1009196.s001

    (TIF)

    Благодарности

    Мы благодарим В. Гупта, К. Монтейт, Х. Бортвик, Х. Коуэн и А. Рид за техническую помощь и подготовку среды, а также Ф. Уолдрона за помощь в извлечении РНК и устранении неполадок с помощью количественной ПЦР. Мы также благодарны М. Крафт и Л. Уайту за подробное обсуждение и активную поддержку проекта.

    Список литературы

    1. 1. Woolhouse MEJ, Dye C, Etard J-F, Smith T., Charlwood JD, Garnett GP, et al.Неоднородности в передаче инфекционных агентов: Труды Национальной академии наук Соединенных Штатов Америки. 1997. 94: 338–342. pmid: 89
    2. 2. Ллойд-Смит Дж.О., Шрайбер С.Дж., Копп П.Е., Гетц В.М., Шрайбер С.Дж., Копп П.Е. и др. Сверхраспространение и влияние индивидуальных особенностей на возникновение болезни. Природа. 2005; 438: 355–9. pmid: 162

    3. 3. Паулл С.Х., Сонг С., МакКлюр К.М., Сакетт Л.С., Килпатрик А.М., Джонсон П.Т. От суперраспространителей к очагам болезней: связь между хостами и пространством.Границы экологии и окружающей среды. 2011; 10: 75–82. pmid: 23482675
    4. 4. Васкес-Прокопек GM, Перкинс Т.А., Уоллер Л.А., Ллойд А.Л., Райнер Р.К., Скотт Т.В. и др. Сопряженные неоднородности и их влияние на передачу паразитов и борьбу с ними. Тенденции паразитологии. 2016; 32: 356–367. pmid: 26850821
    5. 5. Уилсон К., Бьёрнстад О.Н., Добсон А.П., Мерлер С., Поглейн Г., Рид А.Ф. и др. Глава 2: Неоднородности в инфекциях макропаразитов: закономерности и процессы.Экология болезней дикой природы Oxfor University Press, Oxford ,. 2002; 6–44.
    6. 6. Шоу Д. Д., Добсон А. П.. Паттерны численности и агрегации макропаразитов в популяциях диких животных: количественный обзор. Паразитология. 1995; 111: S111 – S133. pmid: 8632918
    7. 7. Брукс-Поллок E, Робертс GO, Килинг MJ. Динамическая модель распространения туберкулеза крупного рогатого скота и борьбы с ним в Великобритании. Природа. 2014; 511: 228–231. pmid: 25008532
    8. 8. Маринели Ф., Цукалас Дж., Караману М., Андроутсос Г.Мэри Мэллон (1869–1938) и история брюшного тифа. Энн Гастроэнтерол. 2013; 26: 132–134. pmid: 24714738
    9. 9. Ли И, Ю ИТС, Сюй П, Ли Дж.Х.В., Вонг Т.В., Оои П.Л. и др. Прогнозирование сверхраспространяющихся событий во время эпидемий тяжелого острого респираторного синдрома 2003 г. в Гонконге и Сингапуре. Американский журнал эпидемиологии. 2004. 160: 719–28. pmid: 15466494
    10. 10. Вонг Г., Лю В., Лю Ю., Чжоу Б., Би И., Гао Г.Ф. MERS, SARS и Эбола: роль суперраспространителей в инфекционных заболеваниях.Клеточный микроб-хозяин. 2015; 18: 398–401. pmid: 26468744
    11. 11. Чжан И, Ли И, Ван Л., Ли М., Чжоу Х. Оценка неоднородности передачи и сверхраспространения COVID-19 в мегаполисе Китая. Int J Environ Res Public Health. 2020; 17. pmid: 32456346
    12. 12. VanderWaal KL, Ezenwa VO. Неоднородность передачи патогенов: механизмы и методология. Функциональная экология. 2016; н / д-н / д.
    13. 13. Streicker DG, Fenton A, Pedersen AB.Различные источники неоднородности видов-хозяев влияют на передачу и контроль паразитов-хозяев. Ecol Lett. 2013; 16: 975–984. pmid: 23714379
    14. 14. Perkins SE, Cattadori IM, Tagliapietra V, Rizzoli AP, Hudson PJ. Эмпирические данные об основных хозяевах персистенции клещевой болезни. Международный журнал паразитологии. 2003. 33: 909–917. pmid: 125
    15. 15. Gervasi SS, Civitello DJ, Kilvitis HJ, Martin LB. Контекст компетентности хозяина: роль пластичности в динамике паразита хозяина.Тенденции паразитологии. 2015; 31: 419–425. pmid: 26048486
    16. 16. Штейн Р.А. Суперраспространители инфекционных заболеваний. Международный журнал инфекционных болезней: IJID: официальное издание Международного общества инфекционных болезней. 2011; 15: e510–3. pmid: 21737332
    17. 17. Центры по контролю и профилактике заболеваний (CDC). Тяжелый острый респираторный синдром — Сингапур, 2003 г. MMWR Morb Mortal Wkly Rep. 2003; 52: 405–411. pmid: 12807088
    18. 18.Килинг М.Дж., Рохани П. Отслеживание контактов в главе 1 работает путем уточнения целей других мер контроля. 1.4. Что такое математические модели? 2007.
    19. 19. Patterson JEH, Ruckstuhl KE. Паразитарная инфекция и размер группы хозяев: метааналитический обзор. Паразитология. 2013; 140: 803–813. pmid: 23425516
    20. 20. Кейзер С.Н., Пинтер-Воллман Н., Августин Д.А., Зиемба М.Дж., Хао Л., Лоуренс Дж.Г. и др. Индивидуальные различия в смелости влияют на модели социальных взаимодействий и передачу кутикулярных бактерий между одноклассниками.Труды Королевского общества B: биологические науки. 2016; 283: 20160457–20160457. pmid: 27097926
    21. 21. Годфри СС. Сети и экология передачи паразитов: основы паразитологии в дикой природе. Международный журнал паразитологии: паразиты и дикая природа. 2013; 2: 235–245. pmid: 24533342
    22. 22. Рашмор Дж., Кайо Д., Матамба Л., Штумпф Р. М., Боргатти С. П., Алтизер С. Анализ социальных сетей диких шимпанзе дает представление о прогнозировании риска инфекционных заболеваний.Журнал экологии животных. 2013; 82: 976–986. pmid: 23734782
    23. 23. де Боно М., Баргманн С.И. Естественные вариации гомолога рецептора нейропептида Y изменяют социальное поведение и пищевую реакцию у C. elegans. Клетка. 1998. 94: 679–89. pmid: 9741632
    24. 24. Кейзер С. Н., Хауэлл К. А., Пинтер-Уоллман Н., Прюитт Дж. Н., Вулхаус М. Е., Корте Р. и др. Состав личности влияет на передачу кутикулярных бактерий в социальных группах. Письма биологии. 2016; 12: 338–342. pmid: 27381885
    25. 25.Saltz JB. ПРИРОДНО-ГЕНЕТИЧЕСКИЕ ИЗМЕНЕНИЯ В ВЫБОРЕ СОЦИАЛЬНОЙ СРЕДЫ: КОНТЕКСТНО-ЗАВИСИМАЯ КОРРЕЛЯЦИЯ ГЕН-СРЕДА В DROSOPHILA MELANOGASTER. Эволюция. 2011; 65: 2325–2334. pmid: 217

    26. 26. Шива-Джоти Дж. А., Вале П. Ф. Вирусная инфекция вызывает специфичные для пола изменения в поведении социальной агрегации плодовой мухи. Письма о биологии. 2019; 630913. pmid: 31530113
    27. 27. Грассли NC, Фрейзер С. Математические модели передачи инфекционных заболеваний. Обзоры природы Микробиология.2008. 6: 234–244. pmid: 18246081
    28. 28. Bou Sleiman MS, Osman D, Massouras A, Hoffmann AA, Lemaitre B, Deplancke B. Генетические, молекулярные и физиологические основы изменчивости иммунокомпетентности кишечника дрозофилы. Nat Commun. 2015; 6. pmid: 26213329
    29. 29. Лаззаро Брайан П., Маленький Том Дж. Иммунитет в изменчивом мире. Философские труды Королевского общества B: биологические науки. 2009; 364: 15–26. pmid: 18

      5

    30. 30. Понтон Ф., Уилсон К., Холмс А.Дж., Коттер С.К., Раубенхаймер Д., Симпсон С.Дж.Интеграция питания и иммунологии: новый рубеж. Журнал физиологии насекомых. 2013. 59: 130–137. pmid: 23159523
    31. 31. Будищак С.А., Сакамото К., Мегоу Л.К., Каммингс К.Р., Урбан Дж.Ф., Эзенва В.О. Ограничение ресурсов изменяет последствия коинфекции как для хозяев, так и для паразитов. Международный журнал паразитологии. 2015; 45: 455–463. pmid: 25812832
    32. 32. Сандра Ласс, Хадсон Питер Дж., Такар Джули, Сарик Жасмина, Харвилл, Альберт Река и др. Создание суперседдеров: коинфекция увеличивает бактериальную нагрузку и яйценоскость желудочно-кишечных гельминтов.Журнал Интерфейса Королевского общества. 2013; 10: 20120588. pmid: 23256186
    33. 33. Cornet S, Bichet C, Larcombe S, Faivre B, Sorci G. Влияние статуса питания хозяина на динамику инфекции и вирулентность паразитов в системе птичьей малярии. J Anim Ecol. 2014; 83: 256–265. pmid: 23

      5
    34. 34. Вале П.Ф., Шуази М., Маленький Т.Дж. Питание хозяина изменяет различия в потенциале передачи паразитов. Biol Lett. 2013; 9. pmid: 23407498
    35. 35. Бельдоменико PM, Бегон М.Распространение болезни, восприимчивость и интенсивность инфекции: порочные круги? Тенденции Ecol Evol (Amst). 2010; 25: 21–27. pmid: 19782425
    36. 36. Capitanio JP, Abel K, Mendoza SP, Blozis SA, McChesney MB, Cole SW и др. Личность и генотип переносчика серотонина взаимодействуют с социальным контекстом, влияя на иммунитет и вирусную установку при заболевании, вызванном вирусом иммунодефицита обезьян. Иммунное поведение мозга. 2008. 22: 676–689. pmid: 17719201
    37. 37. Bolzoni L, Real L, Leo GD. Неоднородность передачи и стратегии контроля возникновения инфекционных заболеваний.PLOS ONE. 2007; 2: e747. pmid: 17712403
    38. 38. Фаррингтон С.П., Уитакер Х.Дж., Ункель С., Пебоди Р. Коррелированные инфекции: количественная оценка индивидуальной неоднородности в распространении инфекционных заболеваний. Am J Epidemiol. 2013; 177: 474–486. pmid: 23403987
    39. 39. Белый LA, Forester JD, Craft ME. Ковариация между физиологическими и поведенческими компонентами передачи патогенов: неоднородность хозяина определяет исход эпидемии. Ойкос. 2018; 127: 538–552.
    40. 40.Стивенсон Дж. Ф. Вызванная паразитами пластичность социального поведения хозяина зависит от пола и восприимчивости. Письма о биологии. 2019; 15: 201

      . pmid: 31744410
    41. 41. Ллойд А.Л., Китрон Ю., Перкинс Т.А., Васкес-Прокопек Г.М., Уоллер Л.А. Базовое репродуктивное число для систем болезней с множественными сопряженными неоднородностями. Математические биологические науки. 2020; 321: 108294. pmid: 31836567
    42. 42. Vale PF, Wilson AJ, Best A, Boots M, Little TJ. Эпидемиологические, эволюционные и коэволюционные последствия контекстно-зависимого паразитизма.Американский натуралист. 2011; 177: 510–521. pmid: 21460572
    43. 43. Susi H, Vale PF, Laine A-L. Генотип хозяина и коинфекция изменяют взаимосвязь внутри и между передачами хозяина. Американский натуралист. 2015; 186: 000–000. pmid: 26655153
    44. 44. Апидианакис Ю., Раме Л.Г. Drosophila melanogaster как модель кишечной инфекции и патологии человека. Dis Model Mech. 2011; 4: 21–30. pmid: 21183483
    45. 45. Бучон Н., Сильверман Н., Черри С.Иммунитет у Drosophila melanogaster — от распознавания микробов до физиологии всего организма. Nat Rev Immunol. 2014; 14: 796–810. pmid: 25421701
    46. 46. Дубнау Ж. Поведенческая генетика мухи (Drosophila Melanogaster). Издательство Кембриджского университета; 2014.
    47. 47. Кейзер С.Н., Рудольф В.Х.В., Сартейн Э., Эвери ЭР, Зальц Дж.Б. Социальный контекст изменяет поведение хозяина и риск заражения. Behav Ecol. 2018; 29: 869–875.
    48. 48. Белый Л.А., Шива-Джоти Дж.А., Крафт МЕНЯ, Вейл П.Ф.Генотипические и половые различия в поведении и восприимчивости хозяев определяют динамику популяционных заболеваний. Труды Королевского общества Б. 2020; под давлением. https://doi.org/10.1101/735480
    49. 49. Арнольд П.А., Джонсон К.Н., Белый CR. Физиологические и метаболические последствия вирусной инфекции у Drosophila melanogaster. Журнал экспериментальной биологии. 2013; 216: 3350–3357. pmid: 23685974
    50. 50. Чтарбанова С., Ламибл О, Ли К-З, Галиана Д., Трокслер Л., Мейгнин С. и др.Системная инфекция вирусом Drosophila C приводит к кишечной непроходимости. Журнал вирусологии. 2014. 88: 14057–14069. pmid: 25253354
    51. 51. Гупта В., Стюарт С., Рунд ССК, Монтейт К., Вейл П.Ф. Затраты и преимущества сублетальной инфекции вирусом Drosophila C. Журнал эволюционной биологии. 2017. pmid: 28425174
    52. 52. Vale PF, Jardine MD. Специфические для пола поведенческие симптомы вирусной кишечной инфекции и Wolbachia у Drosophila melanogaster. Журнал физиологии насекомых.2015; 82: 28–32. pmid: 26301521
    53. 53. Webster CL, Waldron FM, Robertson S, Crowson D, Ferrari G, Quintana JF и др. Открытие, распространение и эволюция вирусов, ассоциированных с Drosophila melanogaster. PLOS Biol. 2015; 13: e1002210. pmid: 26172158
    54. 54. Капун М., Нолте В., Флатт Т., Шлёттерер С. Диапазон хозяев и специфичность вируса C. Drosophila. PLOS ONE. 2010; 5: e12421. pmid: 20865043
    55. 55. Шива-Джоти Дж. А., Монтейт К. М., Вейл П. Ф.Навигация по риску заражения во время откладки яиц и каннибалистического кормления голометаболических насекомых. Behav Ecol. 2018; 29: 1426–1435. pmid: 30510395
    56. 56. Гупта V, Стюарт CO, Rund SSC, Monteith K, Vale PF. Стоимость и преимущества заражения сублетальным вирусом Drosophila C. Журнал эволюционной биологии. 2017; 30: 1325–1335. pmid: 28425174
    57. 57. Magwire MM, Fabian DK, Schweyen H, Cao C, Longdon B, Bayer F и др. Полногеномные исследования ассоциации выявляют простую генетическую основу устойчивости к естественно коэволюционирующим вирусам у Drosophila melanogaster.PLoS Genetics. 2012; 8. pmid: 23166512
    58. 58. Технологии жизни. Руководство пользователя набора для выделения полной РНК MagMAX-96. Карлсбад, Калифорния, США: Life Technologies Corporation; 2011.
    59. 59. Уикхэм Х. ggplot2: Элегантная графика для анализа данных. Springer-Verlag New York; 2016.
    60. 60. Бейтс Д., Мехлер М., Болкер Б., Уолкер С. Подбор линейных моделей со смешанными эффектами с использованием lme4. Журнал статистического программного обеспечения. 2015; 67.
    61. 61. Hothorn T, Bretz F, Westfall P.Одновременный вывод в общих параметрических моделях. Биометрический журнал. 2008. 50: 346–363. pmid: 18481363
    62. 62. Тавалир ВЧ, Блуин М.С., Штайнауэр М.Л. Генотипические вариации в ответе хозяина на инфекцию влияют на репродуктивную способность паразитов. Международный журнал паразитологии. 2016; 46: 123–131. pmid: 26552016
    63. 63. Анаклето О., Кабалейро С., Вильянуэва Б., Саура М., Хьюстон Р. Д., Вуллиамс Дж. А. и др. Генетические различия в инфекционности хозяина влияют на распространение болезни и выживаемость во время эпидемий.Научные отчеты. 2019; 9: 4924. pmid: 30894567
    64. 64. Susi H, Barrès B, Vale PF, Laine A-L. Коинфекция изменяет популяционную динамику инфекционных заболеваний. Nature Communications. 2015; 6: 5975. pmid: 25569306
    65. 65. Дюно Д., Эберт Д. Половой диморфизм хозяина и паразитарная адаптация. PLOS Биология. 2012; 10: e1001271. pmid: 22389630
    66. 66. Феррари Н., Каттадори И.М., Несперейра Дж., Риццоли А., Хадсон П.Дж. Роль пола хозяина в динамике паразита: полевые эксперименты на желтошеей мыши Apodemus flavicollis.Письма об экологии. 2004; 7: 88–94.
    67. 67. Kaltz O, Shykoff JA. Мужские и женские растения Silene latifolia различаются по риску заражения инфекциями, передающимися половым путем, при каждом контакте. Журнал экологии. 2001; 89: 99–109.
    68. 68. Санчес А., Девевей Г., Бизе П. Инфекция, обусловленная самками, и передача желудочно-кишечной нематоды Trichuris arvicolae, заражающей обыкновенную полевку, Microtus arvalis. Международный журнал паразитологии. 2011; 41: 1397–1402. pmid: 22056297
    69. 69.Sheridan LAD, Poulin R, Ward DF, Zuk M. Половые различия в паразитарных инфекциях среди членистоногих-хозяев: есть ли мужское предубеждение? Ойкос. 2000. 88: 327–334.
    70. 70. Томпсон О., Гипсон СЭЙ, Холл, Мэриленд. Влияние пола хозяина на исход коинфекции. Научные отчеты. 2017; 7: 910. pmid: 28424526
    71. 71. Эзенва В.О., Арчи Е.А., Craft ME, Хоули Д.М., Мартин Л.Б., Мур Дж. И др. Обратная связь между поведением хозяина и паразитом: существенная связь между поведением животных и экологией болезни.Proc R Soc B. 2016; 283: 20153078–20153078. pmid: 27053751
    72. 72. Grear DA, Luong LT, Hudson PJ. Передача паразита сложного жизненного цикла по половому признаку: почему мужчины имеют значение. Ойкос. 2012; 121: 1446–1453.
    73. 73. Луонг LT, Grear DA, Hudson PJ. Хозяева-самцы ответственны за передачу трофически передаваемого паразита Pterygodermatites peromysci промежуточному хозяину в отсутствие инфекции, связанной с полом. Международный журнал паразитологии.2009. 39: 1263–1268. pmid: 19397911
    74. 74. Rhines AS. Роль половых различий в распространенности и передаче туберкулеза. Туберкулез. 2013; 93: 104–107. pmid: 23219235
    75. 75. Foo YZ, Nakagawa S, Rhodes G, Simmons LW. Влияние половых гормонов на иммунную функцию: метаанализ. Биологические обзоры. 2017; 92: 551–571. pmid: 26800512
    76. 76. Кейзер CN, Рудольф VHW, Luksik MC, Saltz JB. Половые различия в поведении избегания болезней варьируются в зависимости от способа воздействия патогенов.Этология. 2020; 126: 304–312.
    77. 77. Апгер-МакГлафон Дж., Вольфнер М.Ф. Изменение экскреции спарившихся самок Drosophila melanogaster после спаривания представляет собой долгосрочную реакцию, которая зависит от полового пептида и сперматозоидов. Журнал физиологии насекомых. 2013; 59: 1024–1030. pmid: 238
    78. 78. Altizer S, Nunn CL, Thrall PH, Gittleman JL, Antonovics J, Cunningham AA и др. Социальная организация и риск паразитов у млекопитающих: объединение теории и эмпирических исследований. Ежегодный обзор эволюции и систематики экологии.2003. 34: 517–547.
    79. 79. Тралл PH, Антоновичс Дж., Добсон А.П. Заболевания, передающиеся половым путем, в полигинных системах спаривания: распространенность и влияние на репродуктивный успех. Proc Biol Sci. 2000; 267: 1555–1563. pmid: 11007332
    80. 80. Феррейра Аг, Нейлор Х., Эстевес С.С., Пайс И.С., Мартинс Н.Е., Тейшейра Л. Толл-дорсальный путь необходим для устойчивости к вирусной оральной инфекции у дрозофилы. PLoS Pathog. 2014; 10. pmid: 25473839

    Генетика хозяев и инфекционные болезни: новые инструменты, идеи и возможности трансляции

  • 1.

    Mühlemann, B. et al. Древние вирусы гепатита B от бронзового века до средневековья. Природа 557 , 418–423 (2018).

    PubMed Статья CAS Google Scholar

  • 2.

    Кинтана-Мурси, Л. Иммунология человека через призму эволюционной генетики. Cell 177 , 184–199 (2019).

    CAS PubMed Статья Google Scholar

  • 3.

    Карлссон, Э. К., Квятковски, Д. П. и Сабети, П. С. Естественный отбор и инфекционные заболевания в человеческих популяциях. Нац. Преподобный Жене. 15 , 379–393 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 4.

    Stanaway, J. D. et al. Глобальная, региональная и национальная сравнительная оценка 84 поведенческих, экологических, профессиональных и метаболических рисков или кластеров рисков для 195 стран и территорий, 1990-2017: систематический анализ для исследования глобального бремени болезней 2017. Ланцет 392 , 1923–1994 (2018).

    Артикул Google Scholar

  • 5.

    Wu, F. et al. Новый коронавирус, связанный с респираторным заболеванием человека в Китае. Природа 579 , 265–269 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 6.

    Zhu, N. et al. Новый коронавирус от пациентов с пневмонией в Китае, 2019 год. N. Engl. J. Med. 382 , 727–733 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 7.

    Соренсен Т. И., Нильсен Г. Г., Андерсен П. К. и Тисдейл Т. В. Влияние генетики и окружающей среды на преждевременную смерть взрослых приемных детей. N. Engl. J. Med. 318 , 727–732 (1988). Это ключевое исследование, показывающее, что преждевременная смерть взрослых от инфекций имеет сильную генетическую основу .

    PubMed Статья Google Scholar

  • 8.

    Чепмен, С. Дж. И Хилл, А. В. С. Генетическая предрасположенность человека к инфекционным заболеваниям. Нац. Преподобный Жене. 13 , 175–188 (2012).

    CAS PubMed Статья Google Scholar

  • 9.

    Casanova, J.-L. & Абель, Л. Смертельные инфекционные болезни как врожденные пороки иммунитета: к синтезу зародышевых и генетических теорий. Annu. Преподобный Патол. Мех. Дис. https://doi.org/10.1146/annurev-pathol-031920-101429 (2020).

    Артикул Google Scholar

  • 10.

    Янг, А. И. Решение проблемы отсутствующей наследственности. PLoS Genet. 15 , e1008222 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 11.

    Claussnitzer, M. et al.Краткая история генетики болезней человека. Природа 577 , 179–189 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 12.

    Бойл, Э. А., Ли, Ю. И. и Притчард, Дж. К. Расширенный взгляд на сложные черты: от полигенных до омнигенных. Cell 169 , 1177–1186 (2017). В этой статье предлагается омнигенная модель с наибольшей наследуемостью сложных признаков, объясняемых влиянием на гены вне основных путей .

    CAS PubMed PubMed Central Статья Google Scholar

  • 13.

    Лю, X., Ли, Ю. И. и Притчард, Дж. К. Транс-эффекты на экспрессию генов могут приводить к омнигенному наследованию. Ячейка 177 , 1022–1034.e6 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 14.

    Дендроу, К.А., Петерсен, Дж., Россджон, Дж.& Фуггер, Л. Вариации и болезнь HLA. Нац. Rev. Immunol. 18 , 325–339 (2018).

    CAS PubMed Статья Google Scholar

  • 15.

    Fang, H. et al. Подход, основанный на генетике, определяет целевой ландшафт лекарственного средства по 30 иммунным признакам. Нац. Genet. 51 , 1082–1091 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 16.

    Nelson, M. R. et al. Подтверждение генетических данных человека для утвержденных показаний к лекарствам. Нац. Genet. 47 , 856–860 (2015). Это исследование предоставляет важные доказательства того, что генетически поддерживаемые мишени имеют более высокий процент успеха в клинической разработке .

    CAS PubMed PubMed Central Статья Google Scholar

  • 17.

    Набирочкин С. и др. Перепрофилирование лекарств нового поколения с использованием генетики человека и сетевой биологии. Curr. Opin. Pharmacol. https://doi.org/10.1016/j.coph.2019.12.004 (2020).

    Артикул PubMed Google Scholar

  • 18.

    Эмдин, К. А., Хера, А. В., Катиресан, С. Менделевская рандомизация. JAMA 318 , 1925–1926 (2017).

    PubMed Статья Google Scholar

  • 19.

    Торкамани А., Вайнингер Н. Э. и Тополь Э.J. Личная и клиническая полезность полигенных оценок риска. Нац. Преподобный Жене. 19 , 581–590 (2018).

    CAS Статья PubMed PubMed Central Google Scholar

  • 20.

    Pare, G. et al. Генетический риск геморрагической лихорадки денге и лихорадки денге у нескольких предков. EBioMedicine 51 , 102584 (2020).

    PubMed PubMed Central Статья Google Scholar

  • 21.

    Kaslow, R.A. et al. Влияние комбинаций генов главного комплекса гистосовместимости человека на течение инфекции ВИЧ-1. Нац. Med. 2 , 405–411 (1996).

    CAS PubMed Статья Google Scholar

  • 22.

    Deng, H. K. et al. Идентификация основного корецептора для первичных изолятов ВИЧ-1. Nature 381 , 661–666 (1996).

    CAS PubMed Статья Google Scholar

  • 23.

    Alkhatib, G. et al. CC CKR5: рецептор RANTES, MIP-1α, MIP-1β в качестве кофактора слияния для макрофаготропного ВИЧ-1. Наука 272 , 1955–1958 (1996).

    CAS PubMed Статья Google Scholar

  • 24.

    Dragic, T. et al. Проникновение ВИЧ-1 в клетки CD4 + опосредуется хемокиновым рецептором CC-CKR-5. Nature 381 , 667–673 (1996).

    CAS PubMed Статья Google Scholar

  • 25.

    Carrington, M. et al. HLA и ВИЧ-1: преимущество гетерозигот и недостаток B * 35-Cw * 04. Наука 283 , 1748–1752 (1999). Это основополагающая статья, демонстрирующая доказательства в поддержку избирательного преимущества гетерозиготности в HLA.

    CAS PubMed Статья Google Scholar

  • 26.

    Ramsuran, V. et al. Повышенная экспрессия HLA-A ухудшает контроль над ВИЧ из-за ингибирования клеток, экспрессирующих NKG2A. Наука 359 , 86–90 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 27.

    Jiang, Y. et al. KIR3DS1 / L1 и HLA-Bw4-80I связаны с прогрессированием заболевания ВИЧ среди типичных прогрессоров ВИЧ и длительно не прогрессирующих. BMC Infect. Дис. 13 , 405 (2013).

    PubMed PubMed Central Статья CAS Google Scholar

  • 28.

    Макларен, П. Дж. И Кэррингтон, М. Влияние генетической изменчивости хозяина на инфицирование ВИЧ-1. Нац. Иммунол. 16 , 577–583 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 29.

    Kulkarni, S. et al. Вариация днРНК CCR5AS по-разному регулирует CCR5, влияя на исход заболевания ВИЧ. Нац. Иммунол. 20 , 824–834 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 30.

    Комсток, Г. В. Туберкулез у близнецов: повторный анализ исследования Prophit. Am. Преподобный Респир. Дис. 117 , 621–624 (1978).

    CAS PubMed Google Scholar

  • 31.

    ван дер Эйк, Э. А., ван де Воссе, Э., Ванденбрук, Дж. П. и ван Диссель, Дж. Т. Наследственность против окружающей среды при туберкулезе у близнецов. Am. J. Respir. Крит. Care Med. 176 , 1281–1288 (2007).

    PubMed Статья Google Scholar

  • 32.

    Sveinbjornsson, G. et al. Варианты последовательности HLA класса II влияют на риск заболевания туберкулезом в популяциях европейского происхождения. Нац. Genet. 48 , 318–322 (2016). Эта статья демонстрирует через WGS доказательства ассоциации HLA с инфекцией Mycobacterium tuberculosis .

    CAS PubMed PubMed Central Статья Google Scholar

  • 33.

    Чжэн Р.и другие. Полногеномное ассоциативное исследование идентифицирует два локуса риска туберкулеза у китайцев хань. Нац. Commun. 9 , 4072 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 34.

    Curtis, J. et al. Восприимчивость к туберкулезу связана с вариантами гена ASAP1, кодирующего регулятор миграции дендритных клеток. Нац. Genet. 47 , 523–527 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 35.

    Фава, В. М., Даллманн-Зауэр, М. и Шурр, Э. Генетика проказы: сегодня и за ее пределами. Hum. Genet. 139 , 835–846 (2020).

    PubMed Статья Google Scholar

  • 36.

    Wang, Z. et al. Крупномасштабная ассоциация по всему геному и метаанализ выявили четыре новых локуса восприимчивости к лепре. Нац. Commun. 7 , 13760 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 37.

    Wong, S.H. et al. Проказа и адаптация толл-подобного рецептора человека 1. PLoS Pathog. 6 , e1000979 (2010).

    PubMed PubMed Central Статья CAS Google Scholar

  • 38.

    Чжан Ф.и другие. Идентификация двух новых локусов в IL23R и RAB32, которые влияют на восприимчивость к лепре. Нац. Genet. 43 , 1247–1251 (2011).

    CAS PubMed Статья Google Scholar

  • 39.

    Naranbhai, V. et al. Геномные модуляторы экспрессии генов нейтрофилов человека. Нац. Commun. 6 , 7545 (2015).

    PubMed PubMed Central Статья Google Scholar

  • 40.

    Mayer-Barber, K. D. et al. Терапия туберкулеза, направленная на хозяина, основанная на взаимодействии интерлейкина-1 и интерферона I типа. Природа 511 , 99–103 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 41.

    Cyrklaff, M. et al. Гемоглобины S и C препятствуют ремоделированию актина в эритроцитах, инфицированных Plasmodium falciparum. Наука 334 , 1283–1286 (2011).

    CAS PubMed Статья Google Scholar

  • 42.

    Ки, Ф. М., Тейшейра, Дж. К., де Филиппо, К. и Андрес, А. М. Выгодное разнообразие, поддерживаемое балансирующим отбором у людей. Curr. Opin. Genet. Dev. 29 , 45–51 (2014).

    CAS PubMed Статья Google Scholar

  • 43.

    Сеть геномной эпидемиологии малярии.Переоценка известных локусов устойчивости к малярии в большом многоцентровом исследовании. Нац. Genet. 46 , 1197–1204 (2014).

    PubMed Central Статья CAS Google Scholar

  • 44.

    Сеть геномной эпидемиологии малярии. Новый очаг устойчивости к тяжелой малярии в регионе древнего сбалансированного отбора. Природа 526 , 253–257 (2015). Этот GWAS тяжелой малярии идентифицирует новый локус устойчивости, близкий к генам, кодирующим гликофорины .

    PubMed Central Статья CAS Google Scholar

  • 45.

    Leffler, E. M. et al. Множественные примеры древнего уравновешивающего отбора, общие для людей и шимпанзе. Наука 340 , 1578–1582 (2013).

    Артикул CAS Google Scholar

  • 46.

    Leffler, E. M. et al. Устойчивость к малярии за счет структурных изменений рецепторов инвазии эритроцитов. Наука 356 , 1140–1152 (2017).

    Артикул CAS Google Scholar

  • 47.

    Thomas, D. L. et al. Генетическая изменчивость IL28B и спонтанное избавление от вируса гепатита С. Природа 461 , 798–801 (2009).

    CAS PubMed PubMed Central Статья Google Scholar

  • 48.

    Ge, D. et al. Генетическая изменчивость IL28B позволяет прогнозировать клиренс вируса, вызванный лечением гепатита С. Природа 461 , 399–401 (2009). В этой статье представлены доказательства применения точной медицины с существенной разницей в ответе на терапию, предсказываемой генетическими вариациями человека в районе IFNL4 (также известного как IL28B ) .

    CAS PubMed Статья Google Scholar

  • 49.

    Джонс, К. Р., Флауэр, Б.Ф., Барбер, Э., Симмонс, Б. и Кук, Г. С. Оптимизация лечения гепатита С в эпоху комбинированной противовирусной терапии прямого действия: систематический обзор и метаанализ. Wellcome Open Res . https://doi.org/10.12688/wellcomeopenres.15411.1 (2019).

  • 50.

    Duggal, P. et al. Полногеномное ассоциативное исследование спонтанного разрешения вирусной инфекции гепатита С: данные из нескольких когорт. Ann. Междунар. Med. 158 , 235–245 (2013).

    PubMed PubMed Central Статья Google Scholar

  • 51.

    Vergara, C. et al. Исследование спонтанной элиминации вируса гепатита С на основе полногеномных ассоциаций нескольких предков. Гастроэнтерология 156 , 1496–1507.e7 (2019).

    PubMed Статья Google Scholar

  • 52.

    Harrison, E. M. et al. Этническая принадлежность и исходы COVID-19: проспективное наблюдательное когортное исследование госпитализированных пациентов ISARIC CCP-UK. ССРН Электрон. J . https://doi.org/10.2139/ssrn.3618215 (2020).

  • 53.

    Kowalski, M.H. et al. Использование более 100 000 полногеномных последовательностей консорциума NHLBI Trans-Omics for Precision Medicine (TOPMed) улучшает качество вменения и обнаружение ассоциаций редких вариантов в смешанных популяциях африканцев и испаноязычных / латиноамериканцев. PLoS Genet. 15 , e1008500 (2019).

    PubMed PubMed Central Статья CAS Google Scholar

  • 54.

    Loh, P. R. et al. Фазирование на основе эталонов с использованием панели консорциума эталонных гаплотипов. Нац. Genet. 48 , 1443–1448 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 55.

    Gurdasani, D. et al. Проект изменения африканского генома формирует медицинскую генетику в Африке. Природа 517 , 327–332 (2015). В этой статье описывается генетическое разнообразие африканских особей, демонстрируя важность популяционно-информативного дизайна массива генотипов и вменения .

    CAS PubMed Статья Google Scholar

  • 56.

    Gilly, A. et al. Очень низкоуровневое полногеномное секвенирование в сложных исследованиях ассоциаций признаков. Биоинформатика 35 , 2555–2561 (2019).

    CAS PubMed Статья Google Scholar

  • 57.

    Price, A. L. et al. Анализ основных компонентов корректирует стратификацию в полногеномных ассоциативных исследованиях. Нац. Genet. 38 , 904–909 (2006).

    CAS Статья PubMed PubMed Central Google Scholar

  • 58.

    Янг, Дж., Зейтлен, Н. А., Годдард, М. Э., Вишер, П. М. и Прайс, А. Л. Преимущества и недостатки применения методов ассоциации смешанной модели. Нац. Genet. 46 , 100–106 (2014).

    PubMed PubMed Central Статья CAS Google Scholar

  • 59.

    Wojcik, G. L. et al. Генетический анализ разнообразных популяций улучшает обнаружение сложных признаков. Природа 570 , 514–518 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 60.

    Tian, ​​C. et al. Полногеномные исследования ассоциаций и точного картирования областей HLA выявляют локусы восприимчивости к множественным распространенным инфекциям. Нац. Commun. 8 , 599 (2017). В этой статье представлен GWAS для 23 распространенных инфекций, идентифицирующий локусы HLA и не-HLA .

    PubMed PubMed Central Статья CAS Google Scholar

  • 61.

    McMahon, G., Ring, S.M., Davey-Smith, G. & Timpson, N. J. Полногеномное исследование ассоциации выявляет SNP в локусах MHC класса II, которые связаны с самооценкой коклюша в анамнезе. Hum. Мол. Genet. 24 , 5930–5939 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 62.

    Karnes, J.H. et al. Сканирование по всему феному позволяет выявлять множественные заболевания и фенотипы степени тяжести, связанные с вариантами HLA. Sci. Transl Med. 9 , eaai8708 (2017).

    PubMed PubMed Central Статья Google Scholar

  • 63.

    Чоби, Дж.E. et al. Исследование ассоциации в масштабе всего феномена раскрывает патологическую роль фактора свертывания X во время инфекции Acinetobacter baumannii. Заражение. Иммун. 87 , e00031–19 (2019).

    PubMed PubMed Central Статья Google Scholar

  • 64.

    Chen, J. et al. Факторы свертывания крови VII, IX и X являются эффективными антибактериальными белками против устойчивых к лекарствам грамотрицательных бактерий. Cell Res. 29 , 711–724 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 65.

    Locke, A. E. et al. Секвенирование экзома финских изолятов усиливает ассоциативную силу редких вариантов. Природа 572 , 323–328 (2019). Это исследование секвенирования экзома, показывающее информативность для конкретных популяций, зависящих от генетической истории популяции .

    CAS PubMed PubMed Central Статья Google Scholar

  • 66.

    Bycroft, C. et al. Ресурс UK Biobank с глубоким фенотипированием и геномными данными. Природа 562 , 203–209 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 67.

    Parks, T. et al. Связь между общим аллелем тяжелой цепи иммуноглобулина и риском ревматической болезни сердца в Океании. Нац. Commun. 8 , 14946 (2017). В этой статье представлен важный пример генетической ассоциации с участием локуса IGH .

    PubMed PubMed Central Статья Google Scholar

  • 68.

    Башфорд-Роджерс, Р. Дж. М. и др. Анализ репертуара рецепторов В-клеток при шести иммуноопосредованных заболеваниях. Природа 574 , 122–126 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 69.

    Jain, M. et al. Секвенирование нанопор и сборка генома человека со сверхдлинными считываниями. Нац. Biotechnol. 36 , 338–345 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 70.

    Льюис, Л. А. и Рам, С. Менингококковая инфекция и система комплемента. Вирулентность 5 , 98–126 (2014).

    PubMed Статья Google Scholar

  • 71.

    Schröder-Braunstein, J. & Kirschfink, M.Дефицит комплемента и нарушение регуляции: патофизиологические последствия, современный анализ и клиническое ведение. Мол. Иммунол. 114 , 299–311 (2019).

    PubMed Статья CAS Google Scholar

  • 72.

    Davila, S. et al. Полногеномное ассоциативное исследование выявляет варианты в области CFH, связанные с восприимчивостью хозяина к менингококковой инфекции. Нац. Genet. 42 , 772–776 (2010). Эта статья показывает с помощью GWAS важность генетической изменчивости CFH при инвазивном менингококковом заболевании .

    CAS PubMed Статья Google Scholar

  • 73.

    Bousfiha, A. et al. Врожденные ошибки иммунитета человека: обновление фенотипической классификации IUIS 2019 г. J. Clin. Иммунол. 40 , 66–81 (2020).

    PubMed PubMed Central Статья Google Scholar

  • 74.

    Zhang, S. Y. et al. Дефицит TLR3 у пациентов с энцефалитом простого герпеса. Наука 317 , 1522–1527 (2007).

    CAS PubMed Статья Google Scholar

  • 75.

    Jain, A. et al. Специфические миссенс-мутации в NEMO приводят к синдрому гипер-IgM с гипогидротической эктодермальной дисплазией. Нац. Иммунол. 2 , 223–228 (2001).

    CAS PubMed Статья Google Scholar

  • 76.

    Picard, C. et al. Пиогенные бактериальные инфекции у людей с дефицитом IRAK-4. Наука 299 , 2076–2079 (2003).

    CAS PubMed Статья Google Scholar

  • 77.

    Von Bernuth, H. et al. Пиогенные бактериальные инфекции у людей с дефицитом MyD88. Наука 321 , 691–696 (2008).

    Артикул CAS Google Scholar

  • 78.

    Döffinger, R. et al. Х-сцепленная ангидротическая эктодермальная дисплазия с иммунодефицитом вызывается нарушением передачи сигналов NF-κB. Нац. Genet. 27 , 277–285 (2001).

    PubMed Статья Google Scholar

  • 79.

    Cuchet-Lourenço, D. et al. Двуаллельные мутации RIPK1 у людей вызывают тяжелый иммунодефицит, артрит и воспаление кишечника. Наука 361 , 810–813 (2018). Это образец информативности изучения редких врожденных ошибок иммунитета для понимания иммунной системы .

    PubMed PubMed Central Статья CAS Google Scholar

  • 80.

    Li, Y. et al. Дефицит RIPK1 человека вызывает комбинированный иммунодефицит и воспалительные заболевания кишечника. Proc. Natl Acad. Sci. США 116 , 970–975 (2019).

    CAS PubMed Статья Google Scholar

  • 81.

    Afzali, B. et al. Иммунодефицит BACh3 иллюстрирует связь между суперэнхансерами и гаплонедостаточностью. Нац. Иммунол. 18 , 813–823 (2017).

    CAS PubMed PubMed Central Статья Google Scholar

  • 82.

    Baris, S. et al. Тяжелый комбинированный иммунодефицит с ранним началом из-за гетерозиготных мутаций увеличения функции в STAT1. J. Clin. Иммунол. 36 , 641–648 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 83.

    Higgins, E. et al. Использование руксолитиниба для успешного лечения хронического кожно-слизистого кандидоза, вызванного мутацией преобразователя сигнала и активатора транскрипции 1 (STAT1). J. Allergy Clin. Иммунол. 135 , 551–553.e3 (2015).

    CAS PubMed Статья Google Scholar

  • 84.

    Арнольд Д. Э. и Хеймалл Дж. Р. Обзор хронической гранулематозной болезни. Adv. Ther. 34 , 2543–2557 (2017).

    CAS PubMed PubMed Central Статья Google Scholar

  • 85.

    Arnadottir, G.A. et al. Гомозиготная мутация потери функции, приводящая к дефициту CYBC1, вызывает хроническую гранулематозную болезнь. Нац. Commun. 9 , 4447 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 86.

    Lamborn, I. T. et al. Рецидивирующие риновирусные инфекции у ребенка с наследственной недостаточностью MDA5. J. Exp. Med. 214 , 1949–1972 (2017).

    CAS PubMed PubMed Central Статья Google Scholar

  • 87.

    Ciancanelli, M. J. et al. Инфекционное заболевание. Опасный для жизни грипп и нарушение амплификации интерферона при дефиците IRF7 человека. Наука 348 , 448–453 (2015). Это пример того, как врожденные ошибки иммунитета, связанные с одним геном, могут привести к тяжелой инфекции .

    CAS PubMed PubMed Central Статья Google Scholar

  • 88.

    Hernandez, N. et al. Опасный для жизни гриппозный пневмонит у ребенка с наследственным дефицитом IRF9. J. Exp. Med. 215 , 2567–2585 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 89.

    Lim, H. K. et al. Тяжелая форма гриппозного пневмонита у детей с наследственной недостаточностью TLR3. J. Exp. Med. 216 , 2038–2056 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 90.

    Lindesmith, L. et al. Восприимчивость и устойчивость человека к инфекции вируса Норуолк. Нац. Med. 9 , 548–553 (2003).

    CAS PubMed Статья Google Scholar

  • 91.

    Rosain, J. et al. Менделирующая восприимчивость к микобактериальным заболеваниям: обновленная информация за 2014–2018 гг. Immunol. Cell Biol. 97 , 360–367 (2019).

    PubMed Статья Google Scholar

  • 92.

    Kong, X.-F. и другие. Нарушение антимикобактериальной цепи между дендритными и вспомогательными Т-клетками при дефиците SPPL2a человека. Нац. Иммунол. 19 , 973–985 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 93.

    Kumpf, O. et al. Влияние генетических вариаций TLR4 и TIRAP / Mal на течение сепсиса и пневмонии и выброс цитокинов: обсервационное исследование в трех когортах. Crit. Уход 14 , R103 (2010).

    PubMed PubMed Central Статья Google Scholar

  • 94.

    Khor, C.C. et al. Функциональный вариант Mal связан с защитой от инвазивного пневмококкового заболевания, бактериемии, малярии и туберкулеза. Нац. Genet. 39 , 523–528 (2007).

    CAS PubMed PubMed Central Статья Google Scholar

  • 95.

    Hawn, T. R. et al. Полиморфизм в домене рецептора toll-интерлейкина 1, содержащем адаптерный белок, связан с восприимчивостью к туберкулезу менингеальной оболочки. J. Infect. Дис. 194 , 1127–1134 (2006).

    CAS PubMed PubMed Central Статья Google Scholar

  • 96.

    Ladhani, S. N. et al. Связь между однонуклеотидными полиморфизмами в генах Mal / TIRAP и интерлейкина-10 и восприимчивостью к инвазивной инфекции Haemophilus influenzae серотипа b у иммунизированных детей. Clin. Заразить. Дис. 51 , 761–767 (2010).

    CAS PubMed Статья Google Scholar

  • 97.

    Israel, L. et al. Адаптивный иммунитет человека устраняет врожденную ошибку врожденного иммунитета. Ячейка 168 , 789–800.e10 (2017). В статье демонстрируется неполная пенетрантность при моногенных нарушениях врожденных нарушений иммунитета на примере функциональной характеристики дефицита TIRAP .

    CAS PubMed PubMed Central Статья Google Scholar

  • 98.

    Westermann, A. J. et al. Двойная последовательность РНК раскрывает функции некодирующей РНК во взаимодействиях хозяин-патоген. Природа 529 , 496–501 (2016).

    CAS PubMed Статья Google Scholar

  • 99.

    Nuss, A. M. et al. Двойная последовательность РНК в тканях позволяет быстро обнаруживать специфические для инфекции функции и риборегуляторы, формирующие транскриптомы патоген-хозяин. Proc. Natl Acad. Sci. США 114 , E791 – E800 (2017).

    CAS PubMed Статья Google Scholar

  • 100.

    Монтойя, Д.J. et al. Двойная последовательность РНК в очагах лепры человека определяет бактериальные детерминанты, связанные с иммунным ответом хозяина. Cell Rep. 26 , 3574–3585.e3 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 101.

    Lees, J. A. et al. Совместное секвенирование геномов человека и возбудителя болезни раскрывает генетику пневмококкового менингита. Нац. Commun. 10 , 2176 (2019).

    PubMed PubMed Central Статья CAS Google Scholar

  • 102.

    Ansari, M. A. et al. Анализ генома к геному подчеркивает влияние врожденной и адаптивной иммунной системы человека на вирус гепатита С. Нац. Genet. 49 , 666–673 (2017). Эта статья иллюстрирует успешное применение подхода «геном-геном», подчеркивая взаимодействие между врожденным иммунитетом и вирусным геномом в контроле гепатита С .

    CAS PubMed PubMed Central Статья Google Scholar

  • 103.

    Palmer, D. S. et al. Картирование драйверов эволюции патогенов внутри хозяина с использованием массивных наборов данных. Нац. Commun. 10 , 3017 (2019).

    PubMed PubMed Central Статья CAS Google Scholar

  • 104.

    Karlsson, E. K. et al. Естественный отбор в бангладешской популяции из эндемичной по холере дельты реки Ганг. Sci. Transl Med. 5 , 192ра86 (2013). Эта работа демонстрирует генетическую ассоциацию с устойчивостью к холере с участием генов с убедительными доказательствами отбора, включая гены врожденного иммунитета .

    PubMed PubMed Central Статья Google Scholar

  • 105.

    Amambua-Ngwa, A. et al. Основные субпопуляции Plasmodium falciparum в Африке к югу от Сахары. Наука 365 , 813–816 (2019).

    CAS PubMed Статья Google Scholar

  • 106.

    Howick, V. M. et al. Атлас клеток малярии: транскриптомы отдельных паразитов на протяжении всего жизненного цикла плазмодия. Наука 365 , eaaw2619 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 107.

    Miles, A. et al. Генетическое разнообразие африканского переносчика малярии anopheles gambiae. Природа 552 , 96–100 (2017).

    Артикул CAS Google Scholar

  • 108.

    Näpflin, K. et al. Геномика взаимодействий хозяин-патоген: проблемы и возможности в экологическом и пространственно-временном масштабах. PeerJ 7 , e8013 (2019).

    PubMed PubMed Central Статья Google Scholar

  • 109.

    Давенпорт, Э.E. et al. Геномный ландшафт индивидуальной реакции хозяина и исходов при сепсисе: проспективное когортное исследование. Ланцет Респир. Med. 4 , 259–271 (2016). В этой статье представлены доказательства транскриптомически определенных субфенотипов при сепсисе, которые являются информативными для исхода и состояния иммунного ответа .

    PubMed PubMed Central Статья Google Scholar

  • 110.

    Burnham, K. L. et al.Общие и отдельные аспекты транскриптомного ответа сепсиса на фекальный перитонит и пневмонию. Am. J. Respir. Крит. Care Med. 196 , 328–339 (2017).

    CAS PubMed PubMed Central Статья Google Scholar

  • 111.

    Antcliffe, D. B. et al. Транскриптомные сигнатуры при сепсисе и дифференциальный ответ на стероиды из рандомизированного исследования VaNISH. Am. J. Respir. Крит. Care Med. 199 , 980–986 (2019). В этой статье показано, как субфенотипы сепсиса связаны с дифференциальным ответом на терапию .

    CAS PubMed PubMed Central Статья Google Scholar

  • 112.

    Scicluna, B.P. et al. Классификация пациентов с сепсисом по геномному эндотипу крови: проспективное когортное исследование. Ланцет Респир. Med. 5 , 816–826 (2017).

    PubMed Статья Google Scholar

  • 113.

    Astle, W. J. et al. Аллельный ландшафт вариабельности признаков клеток крови человека и связь с распространенным комплексным заболеванием. Cell 167 , 1415–1429.e19 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 114.

    Jonsson, S. et al. Выявление вариантов последовательностей, влияющих на уровень иммуноглобулинов. Нац. Genet. 49 , 1182–1191 (2017).

    CAS PubMed Статья Google Scholar

  • 115.

    Scepanovic, P. et al. Генетические варианты и возраст человека являются наиболее сильными предикторами гуморального иммунного ответа на распространенные патогены и вакцины. Genome Med. 10 , 59 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 116.

    Hammer, C. et al. Аминокислотная изменчивость белков HLA класса II является основным фактором, определяющим гуморальный ответ на распространенные вирусы. Am. J. Hum. Genet. 97 , 738–743 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 117.

    Roederer, M. et al. Генетическая архитектура иммунной системы человека: биоресурс для аутоиммунитета и патогенеза болезней. Cell 161 , 387–403 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 118.

    Wang, L. et al. Атлас генетических вариаций, связывающих индуцированные патогенами клеточные признаки с болезнями человека. Cell Host Microbe 24 , 308–323.e6 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 119.

    Denny, J. C. et al. Систематическое сравнение исследования ассоциации по всему феномену данных электронных медицинских карт и данных исследования ассоциации по всему геному. Нац. Biotechnol. 31 , 1102–1111 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 120.

    Fairfax, B.P. et al. Генетика экспрессии генов в первичных иммунных клетках определяет основные регуляторы, специфичные для определенного типа клеток, и роли аллелей HLA. Нац. Genet. 44 , 502–510 (2012).

    CAS PubMed PubMed Central Статья Google Scholar

  • 121.

    Quach, H. et al. Генетическая адаптация и примесь неандертальцев сформировали иммунную систему человеческих популяций. Cell 167 , 643–656.e17 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 122.

    Fairfax, B.P. et al. Врожденная иммунная активность обусловливает влияние регуляторных вариантов на экспрессию гена моноцитов. Наука 343 , 1246949 (2014). В этой статье представлены доказательства контекстно-зависимых eQTL при активации врожденного иммунитета .

    PubMed PubMed Central Статья CAS Google Scholar

  • 123.

    Lee, M. N. et al. Распространенные генетические варианты модулируют реакцию чувствительности к патогену в дендритных клетках человека. Наука 343 , 1246980 (2014).

    PubMed PubMed Central Статья CAS Google Scholar

  • 124.

    Nédélec, Y. et al. Генетическое происхождение и естественный отбор определяют популяционные различия в иммунных ответах на патогены. Cell 167 , 657–669.e21 (2016). В этой статье представлены доказательства генетических ассоциаций патогенов и популяций с дифференциальной экспрессией генов .

    PubMed Статья CAS Google Scholar

  • 125.

    Gilchrist, J. J. et al. Риск нетифоидной сальмонеллезной бактериемии у африканских детей изменяется с помощью STAT4. Нац. Commun. 9 , 1014 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 126.

    Kornblihtt, A. R. et al. Альтернативный сплайсинг: ключевой шаг между транскрипцией и трансляцией эукариот. Нац. Rev. Mol. Cell Biol. 14 , 153–165 (2013).

    CAS PubMed Статья Google Scholar

  • 127.

    Rotival, M., Quach, H. & Quintana-Murci, L. Определение генетической и эволюционной архитектуры альтернативного сплайсинга в ответ на инфекцию. Нац. Commun. 10 , 1671 (2019).

    PubMed PubMed Central Статья CAS Google Scholar

  • 128.

    Patin, E. et al. Естественные вариации параметров клеток врожденного иммунитета преимущественно обусловлены ресурсами генетических факторов. Нац.Иммунол. 19 , 302–314 (2018).

    CAS PubMed Статья Google Scholar

  • 129.

    Venet, F., Lukaszewicz, A.C., Payen, D., Hotchkiss, R. & Monneret, G. Мониторинг иммунного ответа при сепсисе: рациональный подход к проведению иммуноадъювантной терапии. Curr. Opin. Иммунол. 25 , 477–483 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 130.

    Li, Y. et al. Подход функциональной геномики для понимания вариабельности производства цитокинов у людей. Cell 167 , 1099–1110.e14 (2016).

    CAS PubMed Статья Google Scholar

  • 131.

    Eisfeld, A.J. et al. Мультиплатформенный анализ патогенеза болезни, вызванной вирусом Эбола, у человека. Cell Host Microbe 22 , 817–829.e8 (2017).

    CAS PubMed PubMed Central Статья Google Scholar

  • 132.

    Менцер А.Дж., О’Коннор Д., Поллард А.Дж. и Хилл А.В.С. Поиск генетических факторов человека, стоящих на пути создания универсально эффективных вакцин. Philos. Пер. R. Soc. B Biol. Sci. 370 , 20140341 ​​(2015).

    Артикул CAS Google Scholar

  • 133.

    Png, E. et al. Полногеномное ассоциативное исследование реакции на вакцину против гепатита В в индонезийской популяции выявило множественные независимые варианты риска в регионе HLA. Hum. Мол. Genet. 20 , 3893–3898 (2011).

    CAS PubMed Статья Google Scholar

  • 134.

    Desombere, I., Willems, A. & Leroux-Roels, G. Ответ на вакцину против гепатита B: задействованы несколько генов HLA. Тканевые антигены 51 , 593–604 (1998).

    CAS PubMed Статья Google Scholar

  • 135.

    Kruger, A. et al. Презентация поверхностного антигена гепатита B и HLA-DRB1 * — уроки близнецов и исследования связывания пептидов. Clin. Exp. Иммунол. 140 , 325–332 (2005).

    CAS PubMed PubMed Central Статья Google Scholar

  • 136.

    Salazar, M. et al. Нормальная презентация HBsAg и дефект Т-лимфоцитов в иммунном ответе у не ответивших. Иммуногенетика 41 , 366–374 (1995).

    CAS PubMed Статья Google Scholar

  • 137.

    Макдермотт, А. Б., Цукерман, Дж. Н., Сабин, С. А., Марш, С. Г. Э. и Мадригал, Дж. А. Вклад лейкоцитарных антигенов человека в реакцию антител на вакцинацию против гепатита В. Тканевые антигены 50 , 8–14 (1997).

    CAS PubMed Статья Google Scholar

  • 138.

    Höhler, T. et al. Влияние генов класса II главного комплекса гистосовместимости и репертуара Vbeta Т-клеток на ответ на иммунизацию HBsAg. Hum. Иммунол. 59 , 212–218 (1998).

    PubMed Статья Google Scholar

  • 139.

    Lambert, N. D. et al. Полиморфизмы HLA-DPB1 связаны с различиями в гуморальном иммунитете к вирусу краснухи после вакцинации. J. Infect.Дис. 211 , 898–905 (2015).

    CAS PubMed Статья Google Scholar

  • 140.

    Овсянникова И.Г., Панкрац В.С., Ларраби Б.Р., Якобсон Р.М. и Поланд Г.А. Генотипы HLA и иммунный ответ на вакцину против краснухи: дополнительные доказательства. Вакцина 32 , 4206–4213 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 141.

    Якобсон, Р.М., Овсянникова, И.Г., Виеркант, Р.А., Шейн Панкрац, В. и Польша, Г.А. Связи антигенов лейкоцитов человека с гуморальным и клеточным иммунитетом после второй дозы вакцины, содержащей корь: устойчивость, ослабление и исчезновение выявленных ассоциаций после первой дозы. Вакцина 29 , 7982–7991 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 142.

    Newport, M. J. et al. Генетическая регуляция иммунных ответов на вакцины в раннем возрасте. Гены. Иммун. 5 , 122–129 (2004).

    CAS PubMed Статья Google Scholar

  • 143.

    O’Connor, D. et al. Общие генетические вариации, связанные с сохранением иммунитета после иммунизации детей. Cell Rep. 27 , 3241–3253.e4 (2019). В этой статье показано, как GWAS можно применить для изучения устойчивости иммунитета после вакцинации детей .

    PubMed Статья CAS Google Scholar

  • 144.

    Zeller, T. et al. Генетика и не только — транскриптом человеческих моноцитов и восприимчивость к болезням. PLoS ONE 5 , e10693 (2010).

    PubMed PubMed Central Статья CAS Google Scholar

  • 145.

    Shaghaghi, M. et al. Комбинированный иммунодефицит с вакцино-ассоциированным паралитическим полиомиелитом: описание случая и описательный обзор литературы. Immunol. Вкладывать деньги. 43 , 292–298 (2014).

    PubMed Статья Google Scholar

  • 146.

    Hernandez, N. et al. Унаследованный дефицит IFNAR1 у здоровых в остальном пациентов пациентов с побочной реакцией на живые вакцины против кори и желтой лихорадки. J. Exp. Med. 216 , 2057–2070 (2019). В этой статье показано, как редкий дефицит IFNAR1 может приводить к опасным для жизни осложнениям после вакцинации живыми аттенуированными вирусами .

    CAS PubMed PubMed Central Статья Google Scholar

  • 147.

    Duncan, C.J.A. et al. Дефицит IFNAR2 человека: уроки противовирусного иммунитета. Sci. Transl Med. 7 , 307ра154 (2015).

    PubMed PubMed Central Статья CAS Google Scholar

  • 148.

    Burns, C. et al. Новое представление гомозиготной мутации STAT-1 с потерей функции у младенца с гипервоспалением — отчет о болезни и обзор литературы. J. Allergy Clin. Иммунол. Практик. 4 , 777–779 (2016).

    PubMed Статья Google Scholar

  • 149.

    Moens, L. et al. Роман, связанный с наследственным дефицитом STAT2 и тяжелым вирусным заболеванием. J. Allergy Clin. Иммунол. 139 , 1995–1997.e9 (2017).

    PubMed Статья Google Scholar

  • 150.

    Дочерти, А.B. et al. Характеристики 20 133 пациентов из Великобритании, находящихся в больнице с covid-19, с использованием протокола клинических характеристик ISARIC ВОЗ: проспективное наблюдательное когортное исследование. BMJ 369 , 1985 г. (2020 г.).

    PubMed PubMed Central Статья Google Scholar

  • 151.

    Williams, F. M. et al. Самостоятельно сообщаемые симптомы covid-19, включая симптомы, наиболее предсказывающие инфекцию SARS-CoV-2, являются наследственными. Препринт по адресу medRxiv https: // doi.org / 10.1101 / 2020.04.22.20072124 (2020).

  • 152.

    Совместная группа «ВОССТАНОВЛЕНИЕ». Дексаметазон у госпитализированных пациентов с covid-19 — предварительное сообщение. N. Engl. J. Med. https://doi.org/10.1056/NEJMoa2021436 (2020).

    Артикул Google Scholar

  • 153.

    COVID-19 Host Genetics Initiative. COVID-19 Host Genetics Initiative, глобальная инициатива по выяснению роли генетических факторов хозяина в восприимчивости и серьезности пандемии вируса SARS-CoV-2. евро. J. Hum. Genet. 28 , 715–718 (2020).

    Артикул CAS Google Scholar

  • 154.

    Casanova, J. L. et al. Глобальные усилия по определению генетики защитного иммунитета человека от инфекции SARS-CoV-2. Cell 181 , 1194–1199 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 155.

    Zhang, X. et al. Факторы вируса и хозяина, связанные с клиническим исходом COVID-19. Природа https://doi.org/10.1038/s41586-020-2355-0 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 156.

    Тяжелый Covid-19 Группа GWAS. Общегеномное исследование ассоциации тяжелой формы COVID-19 с дыхательной недостаточностью. N. Engl. J. Med. https://doi.org/10.1056/NEJMoa2020283 (2020). Это исследование иллюстрирует раннее успешное применение GWAS в пандемии COVID-19, идентифицируя 3p21.31 локус и потенциальная роль для системы групп крови ABO .

  • 157.

    Shelton, J. F. et al. Трансэтнический анализ выявляет генетические и негенетические ассоциации с восприимчивостью и серьезностью COVID-19. Препринт на medRxiv https://doi.org/10.1101/2020.09.04.20188318 (2020).

  • 158.

    Pairo-Castineira, E. et al. Генетические механизмы критического заболевания при Covid-19. Препринт на medRxiv https://doi.org/10.1101/2020.09.24.20200048 (2020).

  • 159.

    Smemo, S. et al. Связанные с ожирением варианты в пределах FTO образуют функциональные связи дальнего действия с IRX3. Природа 507 , 371–375 (2014). Это ключевая статья, показывающая, как варианты GWAS могут действовать на расстоянии .

    CAS PubMed PubMed Central Статья Google Scholar

  • 160.

    Zeberg, H. & Pääbo, S. Главный генетический фактор риска тяжелой формы COVID-19 унаследован от неандертальцев. Природа https://doi.org/10.1038/s41586-020-2818-3 (2020).

    Артикул PubMed Google Scholar

  • 161.

    Nguyen, A. et al. Карта чувствительности лейкоцитарного антигена человека к SARS-CoV-2. J. Virol. https://doi.org/10.1128/JVI.00510-20 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 162.

    Zhang, Q. et al. Врожденные аномалии IFN-иммунитета I типа у пациентов с опасным для жизни COVID-19. Наука 370 , eabd4570 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 163.

    Ублюдок П. и др. Аутоантитела к IFN типа I у пациентов с опасным для жизни COVID-19. Наука 65 , eabd4585 (2020).

    Артикул Google Scholar

  • 164.

    Fellay, J. et al. Полногеномное ассоциативное исследование основных детерминант контроля хозяина ВИЧ-1. Наука 317 , 944–947 (2007).

    CAS PubMed PubMed Central Статья Google Scholar

  • 165.

    Fellay, J. et al. Общие генетические вариации и контроль ВИЧ-1 у людей. PLoS Genet. 5 , e1000791 (2009).

    PubMed PubMed Central Статья CAS Google Scholar

  • 166.

    Перейра, Ф.и другие. Основные генетические детерминанты контроля ВИЧ-1 влияют на презентацию пептида HLA класса I. Наука 330 , 1551–1557 (2010).

    PubMed PubMed Central Статья CAS Google Scholar

  • 167.

    Johnson, E.O. et al. Новый генетический локус, участвующий в приобретении ВИЧ-1 с предполагаемыми регуляторными связями с репликацией и инфекционностью ВИЧ: исследование ассоциации на уровне всего генома. PLoS ONE 10 , e0118149 (2015).

    PubMed PubMed Central Статья CAS Google Scholar

  • 168.

    Wei, Z. et al. Полногеномные исследования ассоциации контроля хозяина ВИЧ-1 в этнически разнообразных китайских популяциях. Sci. Отчет 5 , 10879 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 169.

    McLaren, P.J. et al. Ассоциативное исследование распространенных генетических вариантов и заражения ВИЧ-1 в 6300 инфицированных случаях и 7200 контрольных. PLoS Pathog. 9 , e1003515 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 170.

    McLaren, P.J. et al. Значительный эффект полиморфизма объясняет большую часть генетического вклада хозяина в вариацию вирусной нагрузки ВИЧ-1. Proc. Natl Acad. Sci. США 112 , 14658–14663 (2015). В этом исследовании представлено картирование ассоциации HLA с высоким разрешением для вирусной нагрузки ВИЧ.

    CAS PubMed Статья Google Scholar

  • 171.

    Ekenberg, C. et al. Связь между однонуклеотидными полиморфизмами в аллелях HLA и вирусной нагрузкой вируса иммунодефицита человека типа 1 у демографически разных, не получавших антиретровирусную терапию участников из стратегического времени испытания антиретровирусной терапии. J. Infect. Дис. 220 , 1325–1334 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 172.

    Sobota, R. S. et al. Локус хромосомы 5q31.1 связан с реактивностью кожного туберкулинового теста у ВИЧ-инфицированных из гиперэндемичных по туберкулезу регионов Восточной Африки. PLoS Genet. 13 , e1006710 (2017).

    PubMed PubMed Central Статья CAS Google Scholar

  • 173.

    Luo, Y. et al. Раннее развитие активного туберкулеза — это в высшей степени наследственная черта, обусловленная 3q23 у перуанцев. Нац. Commun. 10 , 3765 (2019). Это генетическое исследование туберкулеза в Перу, показывающее значительную наследственность и новые генетические ассоциации .

    PubMed PubMed Central Статья CAS Google Scholar

  • 174.

    Qi, H. et al. Обнаружение локусов восприимчивости, связанных с туберкулезом, у ханьцев. Hum. Мол. Genet. 26 , 4752–4763 (2017).

    CAS PubMed Статья Google Scholar

  • 175.

    Thye, T. et al. Общие варианты 11p13 связаны с восприимчивостью к туберкулезу. Нац. Genet. 44 , 257–259 (2012).

    CAS PubMed PubMed Central Статья Google Scholar

  • 176.

    Grant, A. V. et al. Полногеномное ассоциативное исследование туберкулеза легких в Марокко. Hum. Genet. 135 , 299–307 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 177.

    Timmann, C. et al. Полногеномное ассоциативное исследование указывает на два новых локуса устойчивости к тяжелой малярии. Природа 489 , 443–446 (2012).

    CAS PubMed Статья Google Scholar

  • 178.

    Liu, H. et al. Открытие шести новых локусов восприимчивости и анализ плейотропных эффектов при лепре. Нац. Genet. 47 , 267–271 (2015).

    PubMed Статья CAS Google Scholar

  • 179.

    Hu, Z. et al. Новые локусы, связанные с хронической инфекцией вируса гепатита В у китайцев хань. Нац. Genet. 45 , 1499–1503 (2013).

    CAS PubMed Статья Google Scholar

  • 180.

    Li, Y. et al. Полногеномное исследование ассоциации выявило связь 8p21.3 с персистирующей инфекцией вируса гепатита B среди китайцев. Нац. Commun. 7 , 11664 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 181.

    Miki, D. et al. HLA-DQB1 * 03 указывает на предрасположенность к хроническому гепатиту С у японцев: исследование ассоциации на уровне всего генома. PLoS ONE 8 , e84226 (2013).

    PubMed PubMed Central Статья CAS Google Scholar

  • 182.

    Khor, C.C. et al. Полногеномное ассоциативное исследование выявляет локусы восприимчивости к синдрому шока денге при MICB и PLCE1. Нац. Genet. 43 , 1139–1141 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 183.

    Dunstan, S.J. et al. Вариация HLA-DRB1 связана с устойчивостью к кишечной лихорадке. Нац. Genet. 46 , 1333–1336 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 184.

    Риверс, Л. и Гаспар, Х. Б. Тяжелый комбинированный иммунодефицит: последние разработки и руководство по клиническому ведению. Arch. Дис. Ребенок. 100 , 667–672 (2015).

    PubMed Статья Google Scholar

  • 185.

    Amirifar, P., Ranjouri, M. R., Yazdani, R., Abolhassani, H. & Aghamohammadi, A. Атаксия-телеангиэктазия: обзор клинических особенностей и молекулярной патологии. Педиатр. Allergy Immunol. 30 , 277–288 (2019).

    PubMed Статья Google Scholar

  • 186.

    Chan, A.C. et al. Дефицит ЗАП-70 при аутосомно-рецессивной форме тяжелого комбинированного иммунодефицита. Наука 264 , 1599–1601 (1994). Эта работа предоставляет важные ранние доказательства генетического исследования пациентов с тяжелым комбинированным иммунодефицитом, подтверждающие функциональную роль ZAP70 в передаче сигнала рецептора Т-клеток .

    CAS PubMed Статья Google Scholar

  • 187.

    Bonilla, F.A. et al. Международный консенсусный документ (ICON): общие вариабельные иммунодефицитные расстройства. J. Allergy Clin. Иммунол. Практик. 4 , 38–59 (2016).

    PubMed Статья Google Scholar

  • 188.

    Сури Д., Рават А. и Сингх С. Х-сцепленная агаммаглобулинемия. Indian J. Pediatr. 83 , 331–337 (2016).

    PubMed Статья Google Scholar

  • 189.

    Yazdani, R. et al. Синдромы гипер-IgM: эпидемиология, патогенез, клинические проявления, диагностика и лечение. Clin. Иммунол. 198 , 19–30 (2019).

    CAS PubMed Статья Google Scholar

  • 190.

    Динауэр, М. С. Нарушения функции нейтрофилов: обзор. Methods Mol. Биол. 1124 , 501–515 (2014).

    CAS PubMed Статья Google Scholar

  • 191.

    Рам, С., Льюис, Л. А. и Райс, П. А. Инфекции людей с дефицитом комплемента и пациентов, перенесших спленэктомию. Clin. Microbiol. Ред. 23 , 740–780 (2010).

    CAS PubMed PubMed Central Статья Google Scholar

  • 192.

    Tangye, T. & XLP, S. G. Клинические особенности и молекулярная этиология, обусловленные мутациями в Sh3D1A, кодирующем SAP. J. Clin. Иммунол. 34 , 772–779 (2014).

    CAS PubMed Статья Google Scholar

  • 193.

    Наум А. Хронический кожно-слизистый кандидоз: спектр генетических нарушений. LymphoSign J. https://doi.org/10.14785/lymphosign-2017-0011 (2017).

    Артикул Google Scholar

  • 194.

    Lanternier, F. et al. Глубокий дерматофитоз и наследственная недостаточность CARD9. N. Engl. J. Med. 369 , 1704–1714 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 195.

    Parham, P. & Moffett, A. Вариабельные рецепторы NK-клеток и их лиганды MHC класса i в иммунитете, репродукции и эволюции человека. Нац. Rev. Immunol. 13 , 133–144 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 196.

    Докинз Р. и др. Геномика главного комплекса гистосовместимости: гаплотипы, дупликация, ретровирусы и болезни. Immunol. Ред. 167 , 275–304 (1999).

    CAS PubMed Статья Google Scholar

  • 197.

    Троусдейл, Дж. И Найт, Дж. С. Геномика главного комплекса гистосовместимости и болезни человека. Annu. Rev. Genomics. Гм. Genet. 14 , 301–323 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 198.

    Parham, P. & Ohta, T. Популяционная биология презентации антигена молекулами MHC класса I. Science 272 , 67–74 (1996).

    CAS PubMed Статья Google Scholar

  • 199.
  • Добавить комментарий

    Ваш адрес email не будет опубликован.